Incidental Mutation 'R4864:Bace1'
ID374758
Institutional Source Beutler Lab
Gene Symbol Bace1
Ensembl Gene ENSMUSG00000032086
Gene Namebeta-site APP cleaving enzyme 1
Synonyms
MMRRC Submission 042474-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R4864 (G1)
Quality Score142
Status Validated
Chromosome9
Chromosomal Location45838580-45864399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45854811 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 179 (I179F)
Ref Sequence ENSEMBL: ENSMUSP00000034591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034591] [ENSMUST00000078111]
Predicted Effect probably damaging
Transcript: ENSMUST00000034591
AA Change: I179F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034591
Gene: ENSMUSG00000032086
AA Change: I179F

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
Pfam:Asp 74 418 3.1e-46 PFAM
Pfam:TAXi_C 259 417 1.2e-13 PFAM
transmembrane domain 455 477 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078111
AA Change: I179F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077249
Gene: ENSMUSG00000032086
AA Change: I179F

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
Pfam:Asp 74 295 9.5e-34 PFAM
Pfam:TAXi_C 290 383 1.5e-8 PFAM
transmembrane domain 421 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159499
SMART Domains Protein: ENSMUSP00000124773
Gene: ENSMUSG00000032086

DomainStartEndE-ValueType
Pfam:Asp 4 61 4.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162559
Predicted Effect unknown
Transcript: ENSMUST00000162587
AA Change: I62F
SMART Domains Protein: ENSMUSP00000124960
Gene: ENSMUSG00000032086
AA Change: I62F

DomainStartEndE-ValueType
Pfam:Asp 1 75 3.6e-9 PFAM
Pfam:Asp 78 277 3.3e-22 PFAM
Pfam:TAXi_C 118 276 1.4e-15 PFAM
transmembrane domain 314 336 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216609
Meta Mutation Damage Score 0.9353 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients. Homozygous knockout mice for this gene exhibit a wide range of nervous system defects, growth retardation, metabolic abnormalities, and increased neonatal lethality. [provided by RefSeq, Nov 2015]
PHENOTYPE: Some alleles with a targeted mutation exhibit small body size, postnatal lethality, hyperactivity, decreased anxiety, and abnormal APP processing by neurons, while others appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Acp6 T C 3: 97,159,367 probably null Het
Adora3 T A 3: 105,907,815 Y148N probably damaging Het
Ahnak2 G A 12: 112,773,606 S538L probably damaging Het
Aox3 T G 1: 58,176,487 V1026G probably damaging Het
Ap3d1 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 10: 80,712,778 probably null Het
Arhgef37 G A 18: 61,494,925 A649V probably benign Het
Atp5a1 G A 18: 77,781,315 R413H possibly damaging Het
Brinp1 A G 4: 68,798,886 F242L probably damaging Het
Brk1 T C 6: 113,615,844 Y63H possibly damaging Het
Ccdc74a A G 16: 17,648,872 T148A probably benign Het
Cenpc1 T A 5: 86,045,321 L236F probably damaging Het
Col13a1 C T 10: 61,862,660 E541K unknown Het
Copg1 T A 6: 87,889,696 C44S probably damaging Het
D130043K22Rik A G 13: 24,863,612 E380G probably damaging Het
Dchs1 T C 7: 105,755,253 D2694G probably damaging Het
Dgkd A T 1: 87,916,838 N242I possibly damaging Het
Dnah2 C T 11: 69,422,590 V4248I probably damaging Het
Dpy19l3 T A 7: 35,712,182 K376* probably null Het
Eef1d A G 15: 75,903,406 S135P possibly damaging Het
Epc2 T A 2: 49,537,165 S574T probably benign Het
Eps15 G A 4: 109,366,530 probably benign Het
Eps8 T C 6: 137,478,969 probably benign Het
Exoc5 A T 14: 49,052,382 V13E probably benign Het
Fbn1 A T 2: 125,372,397 C765S possibly damaging Het
Fbxo5 A T 10: 5,802,392 C74S probably benign Het
Fbxw9 T C 8: 85,065,901 S322P probably damaging Het
Fmo5 T A 3: 97,645,879 I381N probably damaging Het
Fmo6 T C 1: 162,924,395 D175G probably benign Het
Gm11127 T A 17: 36,058,361 probably benign Het
Gm340 G T 19: 41,585,364 A853S probably benign Het
Gm7361 A G 5: 26,262,010 probably null Het
Gm9961 G A 16: 11,903,035 probably benign Het
Golga7b T A 19: 42,266,966 probably null Het
Gorab T C 1: 163,386,398 E321G probably benign Het
Gpx1 T A 9: 108,339,395 V28E probably benign Het
Hist2h3c1 T C 3: 96,247,259 I125T probably damaging Het
Hk1 T C 10: 62,342,539 S8G probably benign Het
Iqsec1 C T 6: 90,664,056 R1026H probably damaging Het
Kdm4b A T 17: 56,353,091 Y86F probably benign Het
Kprp C T 3: 92,824,522 R407Q unknown Het
Lamb1 C T 12: 31,321,006 T1400M probably benign Het
Lrriq3 T A 3: 155,187,810 Y383N possibly damaging Het
Map3k21 T C 8: 125,927,555 I371T probably benign Het
Mllt1 A T 17: 56,905,819 F105I probably damaging Het
Nfatc2 A G 2: 168,536,392 M451T probably damaging Het
Nfkbiz A C 16: 55,818,424 N224K probably damaging Het
Nlrp4d A G 7: 10,381,161 V531A noncoding transcript Het
Noc3l A G 19: 38,789,637 Y778H probably benign Het
Nup98 C A 7: 102,153,196 A734S possibly damaging Het
Olfr1016 A G 2: 85,799,689 Y194H probably damaging Het
Olfr700 T C 7: 106,805,964 Y166C probably damaging Het
Olfr730 T A 14: 50,186,582 I212F probably damaging Het
Olfr824 T A 10: 130,126,887 R57* probably null Het
Pate4 A T 9: 35,608,239 C52S probably damaging Het
Pecr C A 1: 72,277,331 A72S probably benign Het
Pomt1 A G 2: 32,251,992 N578S probably benign Het
Ppm1a T C 12: 72,783,964 S88P probably benign Het
Ppm1l T A 3: 69,542,511 probably benign Het
Prdm13 A G 4: 21,685,543 S86P unknown Het
Prph2 T C 17: 46,910,922 S76P probably benign Het
Sarnp G A 10: 128,833,343 R23H probably damaging Het
Sept1 T C 7: 127,216,892 probably benign Het
Serpini1 T C 3: 75,613,174 I26T probably benign Het
Setdb2 A G 14: 59,409,266 I616T probably benign Het
Slc2a10 T C 2: 165,514,621 F67S probably benign Het
Slc38a6 T A 12: 73,343,650 probably null Het
Smg6 T C 11: 74,930,162 S420P possibly damaging Het
Srp72 T A 5: 76,984,162 H229Q probably benign Het
Ston2 A G 12: 91,648,674 V320A possibly damaging Het
Stx3 A T 19: 11,777,151 I269N possibly damaging Het
Tdg-ps A G 15: 82,516,642 noncoding transcript Het
Tecpr1 T A 5: 144,214,117 N291I probably benign Het
Tmem177 A G 1: 119,910,823 V42A probably benign Het
Trim26 T A 17: 36,857,994 probably benign Het
Ttc17 A G 2: 94,366,635 S456P probably benign Het
Tubgcp6 T C 15: 89,103,818 Y984C probably benign Het
Unc5cl A G 17: 48,459,844 E82G possibly damaging Het
Uncx T C 5: 139,544,120 S43P probably damaging Het
Vmn1r1 A G 1: 182,157,767 V111A probably benign Het
Vmn1r168 A G 7: 23,541,482 I255V probably damaging Het
Vwce A G 19: 10,650,636 T487A probably benign Het
Xaf1 A G 11: 72,306,856 probably benign Het
Zfp27 G T 7: 29,894,836 P568Q probably damaging Het
Zfp382 A T 7: 30,133,460 I179F possibly damaging Het
Other mutations in Bace1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Bace1 APN 9 45839290 critical splice donor site probably null
IGL03378:Bace1 APN 9 45858901 splice site probably null
R0071:Bace1 UTSW 9 45854699 intron probably benign
R1561:Bace1 UTSW 9 45839194 missense probably benign 0.08
R1819:Bace1 UTSW 9 45857162 missense possibly damaging 0.48
R2097:Bace1 UTSW 9 45860222 missense probably benign 0.00
R4067:Bace1 UTSW 9 45854664 missense probably damaging 1.00
R5814:Bace1 UTSW 9 45860264 missense probably damaging 1.00
R5818:Bace1 UTSW 9 45859049 missense possibly damaging 0.94
R6365:Bace1 UTSW 9 45854676 nonsense probably null
R6968:Bace1 UTSW 9 45854965 intron probably null
R7188:Bace1 UTSW 9 45856095 missense probably benign
R7517:Bace1 UTSW 9 45860261 missense probably benign 0.32
R7560:Bace1 UTSW 9 45856139 missense possibly damaging 0.50
R7729:Bace1 UTSW 9 45858445 missense probably damaging 1.00
X0020:Bace1 UTSW 9 45860182 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTCCAGCACATATCGAGACCTC -3'
(R):5'- CACACCCAGCAGTTTTGAAAAGTTTAG -3'

Sequencing Primer
(F):5'- GCACATATCGAGACCTCCGAAAG -3'
(R):5'- GGATTAAACTCATGACTGCTGG -3'
Posted On2016-03-17