Mutagenetix > Incidental Mutation

Incidental Mutation 'R4864:Setdb2'

374777

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

042474-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R4864 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59409266 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 616 (I616T)

Ref Sequence

ENSEMBL: ENSMUSP00000093450 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

probably benign
Transcript: ENSMUST00000095775
AA Change: I616T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: I616T

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159640

Predicted Effect

probably benign
Transcript: ENSMUST00000161459
AA Change: I600T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: I600T

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I06Rik	C	T	14: 63,973,209	R190H	probably benign	Het
Acp6	T	C	3: 97,159,367		probably null	Het
Adora3	T	A	3: 105,907,815	Y148N	probably damaging	Het
Ahnak2	G	A	12: 112,773,606	S538L	probably damaging	Het
Aox3	T	G	1: 58,176,487	V1026G	probably damaging	Het
Ap3d1	TTCTCTCTCTCTCTCTCT	TTCTCTCTCTCTCTCT	10: 80,712,778		probably null	Het
Arhgef37	G	A	18: 61,494,925	A649V	probably benign	Het
Atp5a1	G	A	18: 77,781,315	R413H	possibly damaging	Het
Bace1	A	T	9: 45,854,811	I179F	probably damaging	Het
Brinp1	A	G	4: 68,798,886	F242L	probably damaging	Het
Brk1	T	C	6: 113,615,844	Y63H	possibly damaging	Het
Ccdc74a	A	G	16: 17,648,872	T148A	probably benign	Het
Cenpc1	T	A	5: 86,045,321	L236F	probably damaging	Het
Col13a1	C	T	10: 61,862,660	E541K	unknown	Het
Copg1	T	A	6: 87,889,696	C44S	probably damaging	Het
D130043K22Rik	A	G	13: 24,863,612	E380G	probably damaging	Het
Dchs1	T	C	7: 105,755,253	D2694G	probably damaging	Het
Dgkd	A	T	1: 87,916,838	N242I	possibly damaging	Het
Dnah2	C	T	11: 69,422,590	V4248I	probably damaging	Het
Dpy19l3	T	A	7: 35,712,182	K376*	probably null	Het
Eef1d	A	G	15: 75,903,406	S135P	possibly damaging	Het
Epc2	T	A	2: 49,537,165	S574T	probably benign	Het
Eps15	G	A	4: 109,366,530		probably benign	Het
Eps8	T	C	6: 137,478,969		probably benign	Het
Exoc5	A	T	14: 49,052,382	V13E	probably benign	Het
Fbn1	A	T	2: 125,372,397	C765S	possibly damaging	Het
Fbxo5	A	T	10: 5,802,392	C74S	probably benign	Het
Fbxw9	T	C	8: 85,065,901	S322P	probably damaging	Het
Fmo5	T	A	3: 97,645,879	I381N	probably damaging	Het
Fmo6	T	C	1: 162,924,395	D175G	probably benign	Het
Gm11127	T	A	17: 36,058,361		probably benign	Het
Gm340	G	T	19: 41,585,364	A853S	probably benign	Het
Gm7361	A	G	5: 26,262,010		probably null	Het
Gm9961	G	A	16: 11,903,035		probably benign	Het
Golga7b	T	A	19: 42,266,966		probably null	Het
Gorab	T	C	1: 163,386,398	E321G	probably benign	Het
Gpx1	T	A	9: 108,339,395	V28E	probably benign	Het
Hist2h3c1	T	C	3: 96,247,259	I125T	probably damaging	Het
Hk1	T	C	10: 62,342,539	S8G	probably benign	Het
Iqsec1	C	T	6: 90,664,056	R1026H	probably damaging	Het
Kdm4b	A	T	17: 56,353,091	Y86F	probably benign	Het
Kprp	C	T	3: 92,824,522	R407Q	unknown	Het
Lamb1	C	T	12: 31,321,006	T1400M	probably benign	Het
Lrriq3	T	A	3: 155,187,810	Y383N	possibly damaging	Het
Map3k21	T	C	8: 125,927,555	I371T	probably benign	Het
Mllt1	A	T	17: 56,905,819	F105I	probably damaging	Het
Nfatc2	A	G	2: 168,536,392	M451T	probably damaging	Het
Nfkbiz	A	C	16: 55,818,424	N224K	probably damaging	Het
Nlrp4d	A	G	7: 10,381,161	V531A	noncoding transcript	Het
Noc3l	A	G	19: 38,789,637	Y778H	probably benign	Het
Nup98	C	A	7: 102,153,196	A734S	possibly damaging	Het
Olfr1016	A	G	2: 85,799,689	Y194H	probably damaging	Het
Olfr700	T	C	7: 106,805,964	Y166C	probably damaging	Het
Olfr730	T	A	14: 50,186,582	I212F	probably damaging	Het
Olfr824	T	A	10: 130,126,887	R57*	probably null	Het
Pate4	A	T	9: 35,608,239	C52S	probably damaging	Het
Pecr	C	A	1: 72,277,331	A72S	probably benign	Het
Pomt1	A	G	2: 32,251,992	N578S	probably benign	Het
Ppm1a	T	C	12: 72,783,964	S88P	probably benign	Het
Ppm1l	T	A	3: 69,542,511		probably benign	Het
Prdm13	A	G	4: 21,685,543	S86P	unknown	Het
Prph2	T	C	17: 46,910,922	S76P	probably benign	Het
Sarnp	G	A	10: 128,833,343	R23H	probably damaging	Het
Sept1	T	C	7: 127,216,892		probably benign	Het
Serpini1	T	C	3: 75,613,174	I26T	probably benign	Het
Slc2a10	T	C	2: 165,514,621	F67S	probably benign	Het
Slc38a6	T	A	12: 73,343,650		probably null	Het
Smg6	T	C	11: 74,930,162	S420P	possibly damaging	Het
Srp72	T	A	5: 76,984,162	H229Q	probably benign	Het
Ston2	A	G	12: 91,648,674	V320A	possibly damaging	Het
Stx3	A	T	19: 11,777,151	I269N	possibly damaging	Het
Tdg-ps	A	G	15: 82,516,642		noncoding transcript	Het
Tecpr1	T	A	5: 144,214,117	N291I	probably benign	Het
Tmem177	A	G	1: 119,910,823	V42A	probably benign	Het
Trim26	T	A	17: 36,857,994		probably benign	Het
Ttc17	A	G	2: 94,366,635	S456P	probably benign	Het
Tubgcp6	T	C	15: 89,103,818	Y984C	probably benign	Het
Unc5cl	A	G	17: 48,459,844	E82G	possibly damaging	Het
Uncx	T	C	5: 139,544,120	S43P	probably damaging	Het
Vmn1r1	A	G	1: 182,157,767	V111A	probably benign	Het
Vmn1r168	A	G	7: 23,541,482	I255V	probably damaging	Het
Vwce	A	G	19: 10,650,636	T487A	probably benign	Het
Xaf1	A	G	11: 72,306,856		probably benign	Het
Zfp27	G	T	7: 29,894,836	P568Q	probably damaging	Het
Zfp382	A	T	7: 30,133,460	I179F	possibly damaging	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9525:Setdb2	UTSW	14	59409392	missense	probably benign	0.00
R9743:Setdb2	UTSW	14	59413553	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAGCAGCAGGAATTAAACATCAGG -3'
(R):5'- TTCTGAAGACACACAGCTGAC -3'

Sequencing Primer
(F):5'- GGAAACAACACACATGTCCTG -3'
(R):5'- TCAGACGTGATAGATATAACTGCAAG -3'

Posted On

2016-03-17