Incidental Mutation 'R4864:Mllt1'
ID374790
Institutional Source Beutler Lab
Gene Symbol Mllt1
Ensembl Gene ENSMUSG00000024212
Gene Namemyeloid/lymphoid or mixed-lineage leukemia; translocated to, 1
SynonymsLTG19, BAM11, ENL
MMRRC Submission 042474-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4864 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56892612-56935388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56905819 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 105 (F105I)
Ref Sequence ENSEMBL: ENSMUSP00000025053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025053]
Predicted Effect probably damaging
Transcript: ENSMUST00000025053
AA Change: F105I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025053
Gene: ENSMUSG00000024212
AA Change: F105I

DomainStartEndE-ValueType
Pfam:YEATS 29 110 1.9e-28 PFAM
low complexity region 284 299 N/A INTRINSIC
low complexity region 357 384 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 440 464 N/A INTRINSIC
PDB:2LM0|A 465 547 3e-31 PDB
Meta Mutation Damage Score 0.6203 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (93/94)
MGI Phenotype PHENOTYPE: Embryos homozygous for a knock-out allele die prior to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Acp6 T C 3: 97,159,367 probably null Het
Adora3 T A 3: 105,907,815 Y148N probably damaging Het
Ahnak2 G A 12: 112,773,606 S538L probably damaging Het
Aox3 T G 1: 58,176,487 V1026G probably damaging Het
Ap3d1 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 10: 80,712,778 probably null Het
Arhgef37 G A 18: 61,494,925 A649V probably benign Het
Atp5a1 G A 18: 77,781,315 R413H possibly damaging Het
Bace1 A T 9: 45,854,811 I179F probably damaging Het
Brinp1 A G 4: 68,798,886 F242L probably damaging Het
Brk1 T C 6: 113,615,844 Y63H possibly damaging Het
Ccdc74a A G 16: 17,648,872 T148A probably benign Het
Cenpc1 T A 5: 86,045,321 L236F probably damaging Het
Col13a1 C T 10: 61,862,660 E541K unknown Het
Copg1 T A 6: 87,889,696 C44S probably damaging Het
D130043K22Rik A G 13: 24,863,612 E380G probably damaging Het
Dchs1 T C 7: 105,755,253 D2694G probably damaging Het
Dgkd A T 1: 87,916,838 N242I possibly damaging Het
Dnah2 C T 11: 69,422,590 V4248I probably damaging Het
Dpy19l3 T A 7: 35,712,182 K376* probably null Het
Eef1d A G 15: 75,903,406 S135P possibly damaging Het
Epc2 T A 2: 49,537,165 S574T probably benign Het
Eps15 G A 4: 109,366,530 probably benign Het
Eps8 T C 6: 137,478,969 probably benign Het
Exoc5 A T 14: 49,052,382 V13E probably benign Het
Fbn1 A T 2: 125,372,397 C765S possibly damaging Het
Fbxo5 A T 10: 5,802,392 C74S probably benign Het
Fbxw9 T C 8: 85,065,901 S322P probably damaging Het
Fmo5 T A 3: 97,645,879 I381N probably damaging Het
Fmo6 T C 1: 162,924,395 D175G probably benign Het
Gm11127 T A 17: 36,058,361 probably benign Het
Gm340 G T 19: 41,585,364 A853S probably benign Het
Gm7361 A G 5: 26,262,010 probably null Het
Gm9961 G A 16: 11,903,035 probably benign Het
Golga7b T A 19: 42,266,966 probably null Het
Gorab T C 1: 163,386,398 E321G probably benign Het
Gpx1 T A 9: 108,339,395 V28E probably benign Het
Hist2h3c1 T C 3: 96,247,259 I125T probably damaging Het
Hk1 T C 10: 62,342,539 S8G probably benign Het
Iqsec1 C T 6: 90,664,056 R1026H probably damaging Het
Kdm4b A T 17: 56,353,091 Y86F probably benign Het
Kprp C T 3: 92,824,522 R407Q unknown Het
Lamb1 C T 12: 31,321,006 T1400M probably benign Het
Lrriq3 T A 3: 155,187,810 Y383N possibly damaging Het
Map3k21 T C 8: 125,927,555 I371T probably benign Het
Nfatc2 A G 2: 168,536,392 M451T probably damaging Het
Nfkbiz A C 16: 55,818,424 N224K probably damaging Het
Nlrp4d A G 7: 10,381,161 V531A noncoding transcript Het
Noc3l A G 19: 38,789,637 Y778H probably benign Het
Nup98 C A 7: 102,153,196 A734S possibly damaging Het
Olfr1016 A G 2: 85,799,689 Y194H probably damaging Het
Olfr700 T C 7: 106,805,964 Y166C probably damaging Het
Olfr730 T A 14: 50,186,582 I212F probably damaging Het
Olfr824 T A 10: 130,126,887 R57* probably null Het
Pate4 A T 9: 35,608,239 C52S probably damaging Het
Pecr C A 1: 72,277,331 A72S probably benign Het
Pomt1 A G 2: 32,251,992 N578S probably benign Het
Ppm1a T C 12: 72,783,964 S88P probably benign Het
Ppm1l T A 3: 69,542,511 probably benign Het
Prdm13 A G 4: 21,685,543 S86P unknown Het
Prph2 T C 17: 46,910,922 S76P probably benign Het
Sarnp G A 10: 128,833,343 R23H probably damaging Het
Sept1 T C 7: 127,216,892 probably benign Het
Serpini1 T C 3: 75,613,174 I26T probably benign Het
Setdb2 A G 14: 59,409,266 I616T probably benign Het
Slc2a10 T C 2: 165,514,621 F67S probably benign Het
Slc38a6 T A 12: 73,343,650 probably null Het
Smg6 T C 11: 74,930,162 S420P possibly damaging Het
Srp72 T A 5: 76,984,162 H229Q probably benign Het
Ston2 A G 12: 91,648,674 V320A possibly damaging Het
Stx3 A T 19: 11,777,151 I269N possibly damaging Het
Tdg-ps A G 15: 82,516,642 noncoding transcript Het
Tecpr1 T A 5: 144,214,117 N291I probably benign Het
Tmem177 A G 1: 119,910,823 V42A probably benign Het
Trim26 T A 17: 36,857,994 probably benign Het
Ttc17 A G 2: 94,366,635 S456P probably benign Het
Tubgcp6 T C 15: 89,103,818 Y984C probably benign Het
Unc5cl A G 17: 48,459,844 E82G possibly damaging Het
Uncx T C 5: 139,544,120 S43P probably damaging Het
Vmn1r1 A G 1: 182,157,767 V111A probably benign Het
Vmn1r168 A G 7: 23,541,482 I255V probably damaging Het
Vwce A G 19: 10,650,636 T487A probably benign Het
Xaf1 A G 11: 72,306,856 probably benign Het
Zfp27 G T 7: 29,894,836 P568Q probably damaging Het
Zfp382 A T 7: 30,133,460 I179F possibly damaging Het
Other mutations in Mllt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Mllt1 APN 17 56895086 missense probably damaging 1.00
IGL02554:Mllt1 APN 17 56899806 missense probably benign
IGL03064:Mllt1 APN 17 56900094 missense probably benign 0.03
R2176:Mllt1 UTSW 17 56897398 missense probably benign 0.00
R4455:Mllt1 UTSW 17 56919965 missense probably damaging 1.00
R4760:Mllt1 UTSW 17 56902630 missense probably benign 0.05
R4914:Mllt1 UTSW 17 56899813 missense probably benign
R4916:Mllt1 UTSW 17 56899813 missense probably benign
R4917:Mllt1 UTSW 17 56899813 missense probably benign
R4918:Mllt1 UTSW 17 56899813 missense probably benign
R6169:Mllt1 UTSW 17 56899822 missense probably benign
R6508:Mllt1 UTSW 17 56927054 missense probably damaging 1.00
R7216:Mllt1 UTSW 17 56927042 missense probably damaging 1.00
RF002:Mllt1 UTSW 17 56896300 missense probably benign 0.09
RF002:Mllt1 UTSW 17 56896301 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGAGACATCTTCAGGCTGCTC -3'
(R):5'- GTCAAGTCCTTTGAATGGCAG -3'

Sequencing Primer
(F):5'- TCCACCAGTTAAGGTCTACGTAGG -3'
(R):5'- GTCAAGTCCTTTGAATGGCAGATTAG -3'
Posted On2016-03-17