Incidental Mutation 'R4865:Dnah7b'
ID374798
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Namedynein, axonemal, heavy chain 7B
SynonymsDnahc7b, LOC227058
MMRRC Submission 042475-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R4865 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location46066315-46373546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46195074 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1426 (F1426L)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
Predicted Effect probably damaging
Transcript: ENSMUST00000069293
AA Change: F1426L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: F1426L

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Meta Mutation Damage Score 0.3474 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (86/88)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 C T 18: 61,805,086 V639M probably damaging Het
Adgrf4 A G 17: 42,667,265 S396P probably damaging Het
Aldh3b2 T A 19: 3,978,469 I123N probably damaging Het
Aldh5a1 A G 13: 24,911,584 Y517H probably damaging Het
Aph1c A C 9: 66,827,838 I77S probably damaging Het
Armc8 A G 9: 99,526,889 probably null Het
Atp13a5 G A 16: 29,248,160 P1020L probably damaging Het
BC024139 A T 15: 76,126,066 M80K possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cenpn A G 8: 116,934,773 I204V probably damaging Het
Ces4a A T 8: 105,147,158 M420L probably benign Het
Chdh T A 14: 30,033,724 D322E probably benign Het
Clcn6 A T 4: 148,019,766 I223N probably damaging Het
Clec4b1 A G 6: 123,068,469 K50E possibly damaging Het
Creg1 T A 1: 165,769,863 C135* probably null Het
Cyp4f13 C T 17: 32,925,704 R411Q probably damaging Het
Dock9 A T 14: 121,543,505 *1917R probably null Het
Dync1h1 T G 12: 110,639,801 L2435R possibly damaging Het
Eif3l C A 15: 79,081,649 Y166* probably null Het
Emilin1 T A 5: 30,917,784 N456K possibly damaging Het
Fam83f C T 15: 80,692,449 R434C probably damaging Het
Fbxw9 A G 8: 85,060,156 D10G possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fsip2 T G 2: 82,990,951 V5676G possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm11596 A G 11: 99,793,238 probably benign Het
Gm6522 T C 3: 106,275,970 noncoding transcript Het
Gm6728 A G 6: 136,487,074 noncoding transcript Het
Gria4 T A 9: 4,464,295 I556F possibly damaging Het
Grp A T 18: 65,879,970 D69V probably damaging Het
Gucy1a1 G T 3: 82,119,162 probably benign Het
Haus5 A T 7: 30,658,555 L376Q probably damaging Het
Ifne A T 4: 88,879,705 Y159N probably damaging Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Inpp5b T C 4: 124,751,495 V192A probably benign Het
Kcnh4 A G 11: 100,749,743 S486P probably damaging Het
Kif5b A G 18: 6,222,912 probably benign Het
Macf1 T A 4: 123,433,303 E4800D probably damaging Het
Mblac2 C T 13: 81,711,976 Q150* probably null Het
Mc1r A T 8: 123,407,516 T3S probably benign Het
Med17 G A 9: 15,265,372 Q70* probably null Het
Myocd A T 11: 65,179,030 probably null Het
Nphp3 T C 9: 104,031,970 L793P probably benign Het
Olfr1020 T A 2: 85,849,716 M88K probably damaging Het
Olfr1240 T G 2: 89,439,659 T207P possibly damaging Het
Olfr1377 A G 11: 50,985,543 T281A probably damaging Het
Olfr1436 T C 19: 12,298,580 D184G probably damaging Het
Olfr165 A T 16: 19,407,301 F238L probably damaging Het
Olfr891 T A 9: 38,179,900 T308S possibly damaging Het
Piezo1 A T 8: 122,486,921 L1745Q probably damaging Het
Prdm10 T A 9: 31,347,080 H600Q probably damaging Het
Psapl1 C A 5: 36,204,867 L268M probably damaging Het
Psg23 T C 7: 18,612,114 I219V probably benign Het
Rexo5 A T 7: 119,801,330 R113* probably null Het
Rgs22 A T 15: 36,100,212 I243N probably damaging Het
Rhbdf1 G A 11: 32,214,517 T183I probably damaging Het
Rhobtb1 T C 10: 69,270,724 M373T probably benign Het
Ros1 G T 10: 52,172,870 A88E probably damaging Het
Sdr16c6 A G 4: 4,058,834 F251L probably benign Het
Skil A G 3: 31,113,413 Y398C probably damaging Het
Slc22a3 A T 17: 12,464,532 M148K probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Sntn A T 14: 13,679,103 K92N probably benign Het
Spry4 A T 18: 38,589,823 S296T probably benign Het
St8sia1 A G 6: 142,829,070 F261S probably damaging Het
Stab2 C T 10: 86,843,500 probably null Het
Stk24 A T 14: 121,293,454 C363* probably null Het
Tank G A 2: 61,578,635 probably benign Het
Tmem67 T C 4: 12,070,262 N387S probably benign Het
Treml1 A T 17: 48,366,857 I304L probably benign Het
Trim13 A G 14: 61,605,517 I328V probably benign Het
Upk2 A G 9: 44,454,085 V62A probably damaging Het
Urb2 A T 8: 124,029,635 K694* probably null Het
Vmn2r17 C A 5: 109,427,119 N97K probably damaging Het
Vmn2r57 A T 7: 41,400,468 V619D probably damaging Het
Vmn2r92 G A 17: 18,167,372 R213Q probably benign Het
Wnt6 G A 1: 74,782,629 C123Y probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Zfp52 C T 17: 21,561,243 S451L probably damaging Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46142149 missense probably benign 0.04
IGL00796:Dnah7b APN 1 46211337 missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46224651 missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46066729 unclassified probably benign
IGL00950:Dnah7b APN 1 46214322 missense probably benign 0.07
IGL01142:Dnah7b APN 1 46195378 critical splice donor site probably null
IGL01350:Dnah7b APN 1 46081432 splice site probably benign
IGL01392:Dnah7b APN 1 46126788 missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46116300 splice site probably benign
IGL01460:Dnah7b APN 1 46139704 missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46268653 missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46358147 missense probably benign 0.29
IGL01838:Dnah7b APN 1 46358137 nonsense probably null
IGL01906:Dnah7b APN 1 46175453 missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46124337 splice site probably benign
IGL01989:Dnah7b APN 1 46289534 missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46139875 missense probably benign
IGL02213:Dnah7b APN 1 46233592 missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46226930 missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46099503 nonsense probably null
IGL02381:Dnah7b APN 1 46277120 missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46234193 missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46195318 missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46123777 missense probably benign 0.02
IGL02655:Dnah7b APN 1 46116301 splice site probably benign
IGL02704:Dnah7b APN 1 46142133 missense probably benign 0.03
IGL02719:Dnah7b APN 1 46099608 splice site probably benign
IGL02745:Dnah7b APN 1 46195029 splice site probably benign
IGL02818:Dnah7b APN 1 46290808 missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46119298 missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46182375 missense probably benign 0.00
IGL03354:Dnah7b APN 1 46085689 missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46119304 missense probably benign 0.18
PIT4305001:Dnah7b UTSW 1 46373348 missense probably damaging 1.00
R0116:Dnah7b UTSW 1 46213360 missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46223178 missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46219348 missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46123777 missense probably benign 0.26
R0313:Dnah7b UTSW 1 46207643 missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46134656 missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46240944 missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46277126 missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46236788 missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46140176 missense probably benign 0.00
R0502:Dnah7b UTSW 1 46219544 missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46240992 missense probably benign 0.02
R0664:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46340132 missense probably benign 0.00
R0931:Dnah7b UTSW 1 46099612 splice site probably benign
R1035:Dnah7b UTSW 1 46124448 missense probably benign
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46325810 missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46340120 missense probably benign 0.00
R1318:Dnah7b UTSW 1 46099509 missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46289656 missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46078593 splice site probably benign
R1484:Dnah7b UTSW 1 46137543 missense probably benign 0.00
R1529:Dnah7b UTSW 1 46177281 missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46066797 missense unknown
R1607:Dnah7b UTSW 1 46290646 missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46352966 missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46175390 nonsense probably null
R1681:Dnah7b UTSW 1 46324712 nonsense probably null
R1716:Dnah7b UTSW 1 46191783 missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46233759 missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46116177 missense probably benign 0.04
R1838:Dnah7b UTSW 1 46277105 missense probably damaging 1.00
R1898:Dnah7b UTSW 1 46236714 missense probably benign 0.02
R1962:Dnah7b UTSW 1 46242103 missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46142087 missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46242321 nonsense probably null
R2083:Dnah7b UTSW 1 46241067 missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46097992 splice site probably benign
R2172:Dnah7b UTSW 1 46124512 missense probably benign 0.12
R2239:Dnah7b UTSW 1 46201184 splice site probably benign
R2247:Dnah7b UTSW 1 46277063 missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46233915 missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46362954 missense probably benign 0.31
R2509:Dnah7b UTSW 1 46195287 missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46139741 missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46207572 missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46188687 critical splice donor site probably null
R3022:Dnah7b UTSW 1 46182423 missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46268709 missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46352873 missense probably benign 0.00
R3735:Dnah7b UTSW 1 46299875 missense probably benign 0.05
R3898:Dnah7b UTSW 1 46243257 missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46137485 missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46233711 missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46081495 missense probably benign
R4172:Dnah7b UTSW 1 46226946 missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46137418 missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46221772 missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46337594 splice site probably null
R4414:Dnah7b UTSW 1 46126680 missense probably benign 0.00
R4495:Dnah7b UTSW 1 46085632 missense probably benign 0.00
R4660:Dnah7b UTSW 1 46289536 missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46078524 missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46217157 missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46211328 missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46207656 missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46066955 missense unknown
R4780:Dnah7b UTSW 1 46353014 missense probably benign
R4828:Dnah7b UTSW 1 46128112 missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46356602 missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46081444 missense probably benign 0.21
R4881:Dnah7b UTSW 1 46201318 missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46290775 missense probably benign 0.04
R4960:Dnah7b UTSW 1 46233726 missense probably benign
R5000:Dnah7b UTSW 1 46099503 nonsense probably null
R5005:Dnah7b UTSW 1 46242028 missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46187363 missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46182380 nonsense probably null
R5174:Dnah7b UTSW 1 46243349 missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46358216 missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46233858 missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46373354 missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46233689 missense probably benign 0.16
R5380:Dnah7b UTSW 1 46217191 missense probably benign 0.18
R5387:Dnah7b UTSW 1 46188659 missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46358271 missense probably benign 0.01
R5426:Dnah7b UTSW 1 46242206 missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46242019 missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46109312 missense probably null
R5479:Dnah7b UTSW 1 46223105 missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46242199 missense probably benign 0.06
R5637:Dnah7b UTSW 1 46356514 missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46268764 splice site probably null
R5659:Dnah7b UTSW 1 46352849 missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46233992 missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46277120 missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46142132 missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46191725 missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46337593 critical splice donor site probably null
R5918:Dnah7b UTSW 1 46221643 missense probably benign
R5941:Dnah7b UTSW 1 46187290 missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46362987 missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46119398 intron probably null
R6041:Dnah7b UTSW 1 46289645 missense probably benign 0.04
R6043:Dnah7b UTSW 1 46139789 missense probably benign
R6049:Dnah7b UTSW 1 46085602 missense probably benign
R6131:Dnah7b UTSW 1 46253466 missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46290703 missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46233585 missense probably benign 0.03
R6226:Dnah7b UTSW 1 46126668 missense probably benign 0.01
R6233:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46225888 missense probably benign
R6273:Dnah7b UTSW 1 46242316 missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46340175 missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46242204 nonsense probably null
R6494:Dnah7b UTSW 1 46099431 missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46224742 missense probably benign 0.12
R6800:Dnah7b UTSW 1 46340217 missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46191788 missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46195120 missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46119268 missense probably benign 0.12
R6969:Dnah7b UTSW 1 46358238 missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46195139 critical splice donor site probably null
R7040:Dnah7b UTSW 1 46236809 missense probably benign 0.01
R7117:Dnah7b UTSW 1 46352813 critical splice acceptor site probably null
R7135:Dnah7b UTSW 1 46139710 missense probably damaging 0.99
R7153:Dnah7b UTSW 1 46126804 missense probably benign 0.05
R7189:Dnah7b UTSW 1 46242142 missense probably damaging 1.00
R7237:Dnah7b UTSW 1 46139966 missense probably damaging 0.98
R7243:Dnah7b UTSW 1 46083754 missense probably benign
R7244:Dnah7b UTSW 1 46277143 missense probably damaging 0.99
R7248:Dnah7b UTSW 1 46142085 missense possibly damaging 0.83
R7318:Dnah7b UTSW 1 46195372 missense probably damaging 1.00
R7375:Dnah7b UTSW 1 46303634 missense probably damaging 1.00
R7483:Dnah7b UTSW 1 46175419 missense probably damaging 1.00
R7486:Dnah7b UTSW 1 46290734 missense probably damaging 1.00
R7498:Dnah7b UTSW 1 46325765 missense probably damaging 1.00
R7501:Dnah7b UTSW 1 46356554 missense probably damaging 1.00
R7513:Dnah7b UTSW 1 46124346 missense probably benign 0.06
R7547:Dnah7b UTSW 1 46214413 missense possibly damaging 0.82
R7620:Dnah7b UTSW 1 46268634 missense probably damaging 1.00
R7670:Dnah7b UTSW 1 46109302 missense probably benign
R7676:Dnah7b UTSW 1 46234164 nonsense probably null
R7731:Dnah7b UTSW 1 46139745 missense probably benign 0.00
V8831:Dnah7b UTSW 1 46373298 nonsense probably null
X0023:Dnah7b UTSW 1 46303577 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGTTTCCCAGTTGATCCAAC -3'
(R):5'- ACCTGCATTAATACCTGTGGGAAC -3'

Sequencing Primer
(F):5'- GTTGATCCAACTCTTTATTCACCTAG -3'
(R):5'- CCACAAGTGCAATGAGTTAGCTGTG -3'
Posted On2016-03-17