Incidental Mutation 'R0280:Metrn'
ID37480
Institutional Source Beutler Lab
Gene Symbol Metrn
Ensembl Gene ENSMUSG00000002274
Gene Namemeteorin, glial cell differentiation regulator
Synonyms1810034B16Rik
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R0280 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25794571-25797136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25795135 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 239 (R239H)
Ref Sequence ENSEMBL: ENSMUSP00000127275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002344] [ENSMUST00000072735] [ENSMUST00000095500] [ENSMUST00000165838]
Predicted Effect probably benign
Transcript: ENSMUST00000002344
AA Change: R239H

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000002344
Gene: ENSMUSG00000002274
AA Change: R239H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072735
SMART Domains Protein: ENSMUSP00000072518
Gene: ENSMUSG00000057411

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SCOP:d1f3la_ 65 141 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095500
SMART Domains Protein: ENSMUSP00000093155
Gene: ENSMUSG00000071202

DomainStartEndE-ValueType
Pfam:DUF4472 63 190 5.5e-23 PFAM
coiled coil region 364 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165838
AA Change: R239H

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000127275
Gene: ENSMUSG00000002274
AA Change: R239H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Meta Mutation Damage Score 0.0779 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meteorin regulates glial cell differentiation and promotes the formation of axonal networks during neurogenesis (Nishino et al., 2004 [PubMed 15085178]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Metrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0008:Metrn UTSW 17 25796505 missense possibly damaging 0.94
R0729:Metrn UTSW 17 25796228 splice site probably benign
R1523:Metrn UTSW 17 25794977 makesense probably null
R2119:Metrn UTSW 17 25795223 missense probably benign 0.03
R2146:Metrn UTSW 17 25796627 missense probably damaging 0.99
R4036:Metrn UTSW 17 25795010 missense probably benign
R4037:Metrn UTSW 17 25795010 missense probably benign
R4038:Metrn UTSW 17 25795010 missense probably benign
R4230:Metrn UTSW 17 25796941 unclassified probably benign
R5074:Metrn UTSW 17 25796639 missense probably damaging 1.00
R5259:Metrn UTSW 17 25796540 missense probably damaging 1.00
R5686:Metrn UTSW 17 25795217 missense probably damaging 1.00
R5744:Metrn UTSW 17 25795237 missense probably damaging 1.00
R7707:Metrn UTSW 17 25795410 missense probably benign 0.17
R8108:Metrn UTSW 17 25795030 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCAAACTACGGCACGGTTGCTC -3'
(R):5'- AGCTTAGGGTCTGCCTCACATTCC -3'

Sequencing Primer
(F):5'- TATGCTGCCTGCCACAGAAG -3'
(R):5'- TCAGTCATCACTGTGGTGGT -3'
Posted On2013-05-23