Incidental Mutation 'R4865:Mc1r'
ID374836
Institutional Source Beutler Lab
Gene Symbol Mc1r
Ensembl Gene ENSMUSG00000074037
Gene Namemelanocortin 1 receptor
Synonymsextension recessive yellow, e, Mshra
MMRRC Submission 042475-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4865 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123407107-123410744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123407516 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 3 (T3S)
Ref Sequence ENSEMBL: ENSMUSP00000095929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071134] [ENSMUST00000098324] [ENSMUST00000108840] [ENSMUST00000127664] [ENSMUST00000211932] [ENSMUST00000212470] [ENSMUST00000212571] [ENSMUST00000212743] [ENSMUST00000212880]
Predicted Effect probably benign
Transcript: ENSMUST00000071134
SMART Domains Protein: ENSMUSP00000071134
Gene: ENSMUSG00000062380

DomainStartEndE-ValueType
Tubulin 47 244 8.63e-65 SMART
Tubulin_C 246 383 1.35e-48 SMART
low complexity region 427 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098324
AA Change: T3S

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095929
Gene: ENSMUSG00000074037
AA Change: T3S

DomainStartEndE-ValueType
Pfam:7tm_4 43 188 1.3e-13 PFAM
Pfam:7TM_GPCR_Srsx 47 311 1e-7 PFAM
Pfam:7tm_1 53 296 2.7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108840
SMART Domains Protein: ENSMUSP00000104468
Gene: ENSMUSG00000001472

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 247 588 2.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195600
Predicted Effect probably benign
Transcript: ENSMUST00000211932
Predicted Effect probably benign
Transcript: ENSMUST00000212470
Predicted Effect probably benign
Transcript: ENSMUST00000212571
Predicted Effect probably benign
Transcript: ENSMUST00000212743
Predicted Effect probably benign
Transcript: ENSMUST00000212880
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes the receptor protein for melanocyte-stimulating hormone (MSH). The encoded protein, a seven pass transmembrane G protein coupled receptor, controls melanogenesis. Two types of melanin exist: red pheomelanin and black eumelanin. Gene mutations that lead to a loss in function are associated with increased pheomelanin production, which leads to lighter skin and hair color. Eumelanin is photoprotective but pheomelanin may contribute to UV-induced skin damage by generating free radicals upon UV radiation. Binding of MSH to its receptor activates the receptor and stimulates eumelanin synthesis. This receptor is a major determining factor in sun sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer. Over 30 variant alleles have been identified which correlate with skin and hair color, providing evidence that this gene is an important component in determining normal human pigment variation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant alleles at this locus extend or restrict the amount of black pigment (eumelanin) in hair with the opposite effect on yellow pigment (phaeomelanin). Some variants affect pain sensitivity. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(2) Spontaneous(6) Chemically induced(2)
Mutant alleles at this locus extend or restrict the amount of black pigment (eumelanin) in hair with the opposite effect on yellow pigment (phaeomelanin). Some variants affect pain sensitivity.

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 C T 18: 61,805,086 V639M probably damaging Het
Adgrf4 A G 17: 42,667,265 S396P probably damaging Het
Aldh3b2 T A 19: 3,978,469 I123N probably damaging Het
Aldh5a1 A G 13: 24,911,584 Y517H probably damaging Het
Aph1c A C 9: 66,827,838 I77S probably damaging Het
Armc8 A G 9: 99,526,889 probably null Het
Atp13a5 G A 16: 29,248,160 P1020L probably damaging Het
BC024139 A T 15: 76,126,066 M80K possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cenpn A G 8: 116,934,773 I204V probably damaging Het
Ces4a A T 8: 105,147,158 M420L probably benign Het
Chdh T A 14: 30,033,724 D322E probably benign Het
Clcn6 A T 4: 148,019,766 I223N probably damaging Het
Clec4b1 A G 6: 123,068,469 K50E possibly damaging Het
Creg1 T A 1: 165,769,863 C135* probably null Het
Cyp4f13 C T 17: 32,925,704 R411Q probably damaging Het
Dnah7b T C 1: 46,195,074 F1426L probably damaging Het
Dock9 A T 14: 121,543,505 *1917R probably null Het
Dync1h1 T G 12: 110,639,801 L2435R possibly damaging Het
Eif3l C A 15: 79,081,649 Y166* probably null Het
Emilin1 T A 5: 30,917,784 N456K possibly damaging Het
Fam83f C T 15: 80,692,449 R434C probably damaging Het
Fbxw9 A G 8: 85,060,156 D10G possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fsip2 T G 2: 82,990,951 V5676G possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm11596 A G 11: 99,793,238 probably benign Het
Gm6522 T C 3: 106,275,970 noncoding transcript Het
Gm6728 A G 6: 136,487,074 noncoding transcript Het
Gria4 T A 9: 4,464,295 I556F possibly damaging Het
Grp A T 18: 65,879,970 D69V probably damaging Het
Gucy1a1 G T 3: 82,119,162 probably benign Het
Haus5 A T 7: 30,658,555 L376Q probably damaging Het
Ifne A T 4: 88,879,705 Y159N probably damaging Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Inpp5b T C 4: 124,751,495 V192A probably benign Het
Kcnh4 A G 11: 100,749,743 S486P probably damaging Het
Kif5b A G 18: 6,222,912 probably benign Het
Macf1 T A 4: 123,433,303 E4800D probably damaging Het
Mblac2 C T 13: 81,711,976 Q150* probably null Het
Med17 G A 9: 15,265,372 Q70* probably null Het
Myocd A T 11: 65,179,030 probably null Het
Nphp3 T C 9: 104,031,970 L793P probably benign Het
Olfr1020 T A 2: 85,849,716 M88K probably damaging Het
Olfr1240 T G 2: 89,439,659 T207P possibly damaging Het
Olfr1377 A G 11: 50,985,543 T281A probably damaging Het
Olfr1436 T C 19: 12,298,580 D184G probably damaging Het
Olfr165 A T 16: 19,407,301 F238L probably damaging Het
Olfr891 T A 9: 38,179,900 T308S possibly damaging Het
Piezo1 A T 8: 122,486,921 L1745Q probably damaging Het
Prdm10 T A 9: 31,347,080 H600Q probably damaging Het
Psapl1 C A 5: 36,204,867 L268M probably damaging Het
Psg23 T C 7: 18,612,114 I219V probably benign Het
Rexo5 A T 7: 119,801,330 R113* probably null Het
Rgs22 A T 15: 36,100,212 I243N probably damaging Het
Rhbdf1 G A 11: 32,214,517 T183I probably damaging Het
Rhobtb1 T C 10: 69,270,724 M373T probably benign Het
Ros1 G T 10: 52,172,870 A88E probably damaging Het
Sdr16c6 A G 4: 4,058,834 F251L probably benign Het
Skil A G 3: 31,113,413 Y398C probably damaging Het
Slc22a3 A T 17: 12,464,532 M148K probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Sntn A T 14: 13,679,103 K92N probably benign Het
Spry4 A T 18: 38,589,823 S296T probably benign Het
St8sia1 A G 6: 142,829,070 F261S probably damaging Het
Stab2 C T 10: 86,843,500 probably null Het
Stk24 A T 14: 121,293,454 C363* probably null Het
Tank G A 2: 61,578,635 probably benign Het
Tmem67 T C 4: 12,070,262 N387S probably benign Het
Treml1 A T 17: 48,366,857 I304L probably benign Het
Trim13 A G 14: 61,605,517 I328V probably benign Het
Upk2 A G 9: 44,454,085 V62A probably damaging Het
Urb2 A T 8: 124,029,635 K694* probably null Het
Vmn2r17 C A 5: 109,427,119 N97K probably damaging Het
Vmn2r57 A T 7: 41,400,468 V619D probably damaging Het
Vmn2r92 G A 17: 18,167,372 R213Q probably benign Het
Wnt6 G A 1: 74,782,629 C123Y probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Zfp52 C T 17: 21,561,243 S451L probably damaging Het
Other mutations in Mc1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Mc1r APN 8 123408050 missense probably damaging 1.00
IGL02878:Mc1r APN 8 123407630 missense probably damaging 1.00
deer UTSW 8 123407958 missense probably damaging 1.00
R1240:Mc1r UTSW 8 123408260 missense probably damaging 1.00
R1871:Mc1r UTSW 8 123407536 missense probably benign
R2071:Mc1r UTSW 8 123408369 missense possibly damaging 0.84
R4006:Mc1r UTSW 8 123407637 missense probably damaging 1.00
R4226:Mc1r UTSW 8 123407856 missense possibly damaging 0.88
R6652:Mc1r UTSW 8 123407631 missense probably damaging 1.00
R6765:Mc1r UTSW 8 123407696 missense probably damaging 1.00
R7580:Mc1r UTSW 8 123408167 missense probably damaging 1.00
R7609:Mc1r UTSW 8 123408293 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTCAGCAGGAAGTGTCTATGC -3'
(R):5'- TGATGGCTATCACAACCAGC -3'

Sequencing Primer
(F):5'- AGGAAGTGTCTATGCCATGCC -3'
(R):5'- GATGGCTATCACAACCAGCACATTC -3'
Posted On2016-03-17