Incidental Mutation 'R0280:Sufu'
ID 37484
Institutional Source Beutler Lab
Gene Symbol Sufu
Ensembl Gene ENSMUSG00000025231
Gene Name SUFU negative regulator of hedgehog signaling
Synonyms b2b273Clo, Su(Fu), 2810026F04Rik
MMRRC Submission 038502-MU
Accession Numbers

Ncbi RefSeq: NM_015752.2; NM_001025391.1; MGI:1345643

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0280 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 46396896-46488804 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 46450673 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039922] [ENSMUST00000111867] [ENSMUST00000118440] [ENSMUST00000120778]
AlphaFold Q9Z0P7
Predicted Effect probably benign
Transcript: ENSMUST00000039922
SMART Domains Protein: ENSMUSP00000049109
Gene: ENSMUSG00000025231

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
Pfam:SUFU 63 242 2.9e-38 PFAM
Pfam:SUFU_C 252 473 1.6e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111867
SMART Domains Protein: ENSMUSP00000107498
Gene: ENSMUSG00000025231

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
Pfam:SUFU 64 241 4.9e-54 PFAM
Pfam:SUFU_C 254 474 2.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118440
SMART Domains Protein: ENSMUSP00000113073
Gene: ENSMUSG00000025231

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
Pfam:SUFU 63 242 3.2e-38 PFAM
Pfam:SUFU_C 252 436 9.8e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120778
SMART Domains Protein: ENSMUSP00000112653
Gene: ENSMUSG00000025231

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
Pfam:SUFU 59 197 4.8e-30 PFAM
Pfam:SUFU_C 208 297 2e-29 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
MGI Phenotype Strain: 3512046; 3619046
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Hedgehog signaling pathway plays an important role in early human development. The pathway is a signaling cascade that plays a role in pattern formation and cellular proliferation during development. This gene encodes a negative regulator of the hedgehog signaling pathway. Defects in this gene are a cause of medulloblastoma. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Targeted disruption results in mid-gestation lethality, embryonic growth retardation, incomplete embryo turning, open neural tube, abnormal somite development, left-right asymmetry defects resulting in cardiac looping, and hemorrhage in the diencephalon. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted(7) Gene trapped(25)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Sufu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Sufu APN 19 46450943 missense probably damaging 1.00
IGL01613:Sufu APN 19 46475620 missense probably damaging 1.00
IGL01652:Sufu APN 19 46475620 missense probably damaging 1.00
IGL02420:Sufu APN 19 46425042 missense probably damaging 1.00
IGL02501:Sufu APN 19 46450910 missense probably benign 0.04
IGL02984:Sufu UTSW 19 46473599 missense probably benign
P0018:Sufu UTSW 19 46475494 splice site probably benign
R0172:Sufu UTSW 19 46397124 missense possibly damaging 0.86
R1175:Sufu UTSW 19 46401264 splice site probably null
R1295:Sufu UTSW 19 46454720 splice site probably benign
R1296:Sufu UTSW 19 46454720 splice site probably benign
R1420:Sufu UTSW 19 46397184 missense probably benign 0.36
R1846:Sufu UTSW 19 46450947 missense possibly damaging 0.47
R2061:Sufu UTSW 19 46397212 missense probably damaging 1.00
R4082:Sufu UTSW 19 46425102 missense probably damaging 0.99
R4151:Sufu UTSW 19 46449972 critical splice donor site probably null
R4744:Sufu UTSW 19 46483630 missense possibly damaging 0.78
R4751:Sufu UTSW 19 46483649 missense probably benign 0.01
R4959:Sufu UTSW 19 46475552 missense possibly damaging 0.58
R4973:Sufu UTSW 19 46475552 missense possibly damaging 0.58
R5221:Sufu UTSW 19 46450965 critical splice donor site probably null
R5890:Sufu UTSW 19 46454733 critical splice acceptor site probably null
R6030:Sufu UTSW 19 46475539 missense probably damaging 0.99
R6030:Sufu UTSW 19 46475539 missense probably damaging 0.99
R6226:Sufu UTSW 19 46473654 missense probably damaging 1.00
R6233:Sufu UTSW 19 46475632 missense probably damaging 1.00
R6811:Sufu UTSW 19 46449878 missense probably damaging 1.00
R6923:Sufu UTSW 19 46450966 splice site probably null
R7095:Sufu UTSW 19 46475588 missense probably damaging 1.00
R7223:Sufu UTSW 19 46453277 missense possibly damaging 0.82
R7390:Sufu UTSW 19 46450669 splice site probably null
R8190:Sufu UTSW 19 46401197 nonsense probably null
R9424:Sufu UTSW 19 46485881 nonsense probably null
R9433:Sufu UTSW 19 46397093 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GGGAGCCATTACATTTTGGGGACAC -3'
(R):5'- GCCTGCATTGATCGGCAGACATAG -3'

Sequencing Primer
(F):5'- TACATTTTGGGGACACCAGCC -3'
(R):5'- ATCGGCAGACATAGCCTTTG -3'
Posted On 2013-05-23