Incidental Mutation 'R4865:Ros1'
ID374846
Institutional Source Beutler Lab
Gene Symbol Ros1
Ensembl Gene ENSMUSG00000019893
Gene NameRos1 proto-oncogene
SynonymsRos-1, c-ros
MMRRC Submission 042475-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R4865 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location52045721-52195244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 52172870 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 88 (A88E)
Ref Sequence ENSEMBL: ENSMUSP00000151932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]
Predicted Effect probably damaging
Transcript: ENSMUST00000020045
AA Change: A97E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: A97E

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 568 654 2.24e-4 SMART
LY 734 776 2.28e1 SMART
LY 777 815 4.61e0 SMART
FN3 944 1023 5.53e-4 SMART
FN3 1037 1133 1.07e1 SMART
FN3 1440 1532 1.19e1 SMART
FN3 1551 1637 2.11e0 SMART
FN3 1649 1731 6.8e-4 SMART
FN3 1746 1832 2.7e1 SMART
TyrKc 1938 2208 1.3e-145 SMART
low complexity region 2294 2307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117992
AA Change: A97E

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: A97E

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
TyrKc 1917 2187 1.3e-145 SMART
low complexity region 2273 2286 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175892
AA Change: A88E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135235
Gene: ENSMUSG00000019893
AA Change: A88E

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 100 178 1.05e-4 SMART
FN3 196 273 7.45e-10 SMART
Blast:LY 360 400 1e-20 BLAST
Blast:LY 449 486 4e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000177378
AA Change: A97E

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: A97E

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
Blast:LY 1190 1236 2e-18 BLAST
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
transmembrane domain 1832 1854 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218452
AA Change: A97E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000219173
AA Change: A97E

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000219692
AA Change: A88E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.0902 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 C T 18: 61,805,086 V639M probably damaging Het
Adgrf4 A G 17: 42,667,265 S396P probably damaging Het
Aldh3b2 T A 19: 3,978,469 I123N probably damaging Het
Aldh5a1 A G 13: 24,911,584 Y517H probably damaging Het
Aph1c A C 9: 66,827,838 I77S probably damaging Het
Armc8 A G 9: 99,526,889 probably null Het
Atp13a5 G A 16: 29,248,160 P1020L probably damaging Het
BC024139 A T 15: 76,126,066 M80K possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cenpn A G 8: 116,934,773 I204V probably damaging Het
Ces4a A T 8: 105,147,158 M420L probably benign Het
Chdh T A 14: 30,033,724 D322E probably benign Het
Clcn6 A T 4: 148,019,766 I223N probably damaging Het
Clec4b1 A G 6: 123,068,469 K50E possibly damaging Het
Creg1 T A 1: 165,769,863 C135* probably null Het
Cyp4f13 C T 17: 32,925,704 R411Q probably damaging Het
Dnah7b T C 1: 46,195,074 F1426L probably damaging Het
Dock9 A T 14: 121,543,505 *1917R probably null Het
Dync1h1 T G 12: 110,639,801 L2435R possibly damaging Het
Eif3l C A 15: 79,081,649 Y166* probably null Het
Emilin1 T A 5: 30,917,784 N456K possibly damaging Het
Fam83f C T 15: 80,692,449 R434C probably damaging Het
Fbxw9 A G 8: 85,060,156 D10G possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fsip2 T G 2: 82,990,951 V5676G possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm11596 A G 11: 99,793,238 probably benign Het
Gm6522 T C 3: 106,275,970 noncoding transcript Het
Gm6728 A G 6: 136,487,074 noncoding transcript Het
Gria4 T A 9: 4,464,295 I556F possibly damaging Het
Grp A T 18: 65,879,970 D69V probably damaging Het
Gucy1a1 G T 3: 82,119,162 probably benign Het
Haus5 A T 7: 30,658,555 L376Q probably damaging Het
Ifne A T 4: 88,879,705 Y159N probably damaging Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Inpp5b T C 4: 124,751,495 V192A probably benign Het
Kcnh4 A G 11: 100,749,743 S486P probably damaging Het
Kif5b A G 18: 6,222,912 probably benign Het
Macf1 T A 4: 123,433,303 E4800D probably damaging Het
Mblac2 C T 13: 81,711,976 Q150* probably null Het
Mc1r A T 8: 123,407,516 T3S probably benign Het
Med17 G A 9: 15,265,372 Q70* probably null Het
Myocd A T 11: 65,179,030 probably null Het
Nphp3 T C 9: 104,031,970 L793P probably benign Het
Olfr1020 T A 2: 85,849,716 M88K probably damaging Het
Olfr1240 T G 2: 89,439,659 T207P possibly damaging Het
Olfr1377 A G 11: 50,985,543 T281A probably damaging Het
Olfr1436 T C 19: 12,298,580 D184G probably damaging Het
Olfr165 A T 16: 19,407,301 F238L probably damaging Het
Olfr891 T A 9: 38,179,900 T308S possibly damaging Het
Piezo1 A T 8: 122,486,921 L1745Q probably damaging Het
Prdm10 T A 9: 31,347,080 H600Q probably damaging Het
Psapl1 C A 5: 36,204,867 L268M probably damaging Het
Psg23 T C 7: 18,612,114 I219V probably benign Het
Rexo5 A T 7: 119,801,330 R113* probably null Het
Rgs22 A T 15: 36,100,212 I243N probably damaging Het
Rhbdf1 G A 11: 32,214,517 T183I probably damaging Het
Rhobtb1 T C 10: 69,270,724 M373T probably benign Het
Sdr16c6 A G 4: 4,058,834 F251L probably benign Het
Skil A G 3: 31,113,413 Y398C probably damaging Het
Slc22a3 A T 17: 12,464,532 M148K probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Sntn A T 14: 13,679,103 K92N probably benign Het
Spry4 A T 18: 38,589,823 S296T probably benign Het
St8sia1 A G 6: 142,829,070 F261S probably damaging Het
Stab2 C T 10: 86,843,500 probably null Het
Stk24 A T 14: 121,293,454 C363* probably null Het
Tank G A 2: 61,578,635 probably benign Het
Tmem67 T C 4: 12,070,262 N387S probably benign Het
Treml1 A T 17: 48,366,857 I304L probably benign Het
Trim13 A G 14: 61,605,517 I328V probably benign Het
Upk2 A G 9: 44,454,085 V62A probably damaging Het
Urb2 A T 8: 124,029,635 K694* probably null Het
Vmn2r17 C A 5: 109,427,119 N97K probably damaging Het
Vmn2r57 A T 7: 41,400,468 V619D probably damaging Het
Vmn2r92 G A 17: 18,167,372 R213Q probably benign Het
Wnt6 G A 1: 74,782,629 C123Y probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Zfp52 C T 17: 21,561,243 S451L probably damaging Het
Other mutations in Ros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ros1 APN 10 52194890 missense probably benign 0.01
IGL00338:Ros1 APN 10 52125811 missense probably benign
IGL00419:Ros1 APN 10 52091054 missense probably damaging 0.97
IGL00840:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00841:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00951:Ros1 APN 10 52143252 missense probably damaging 0.99
IGL01123:Ros1 APN 10 52120809 missense probably damaging 1.00
IGL01128:Ros1 APN 10 52142328 nonsense probably null
IGL01300:Ros1 APN 10 52101713 missense probably benign 0.01
IGL01316:Ros1 APN 10 52087879 critical splice donor site probably null
IGL01349:Ros1 APN 10 52051026 missense probably damaging 0.99
IGL01363:Ros1 APN 10 52166142 missense probably damaging 1.00
IGL01457:Ros1 APN 10 52046330 splice site probably benign
IGL01532:Ros1 APN 10 52090938 splice site probably benign
IGL01585:Ros1 APN 10 52155102 missense probably damaging 1.00
IGL01650:Ros1 APN 10 52154979 missense probably damaging 0.99
IGL01672:Ros1 APN 10 52101803 missense possibly damaging 0.92
IGL01904:Ros1 APN 10 52077911 missense probably damaging 0.97
IGL02040:Ros1 APN 10 52115922 missense probably damaging 0.99
IGL02053:Ros1 APN 10 52162720 missense probably damaging 1.00
IGL02147:Ros1 APN 10 52120895 missense probably damaging 1.00
IGL02169:Ros1 APN 10 52081957 critical splice donor site probably null
IGL02247:Ros1 APN 10 52129581 missense probably damaging 0.99
IGL02262:Ros1 APN 10 52178969 missense probably damaging 0.96
IGL02307:Ros1 APN 10 52128438 missense possibly damaging 0.53
IGL02398:Ros1 APN 10 52144884 splice site probably benign
IGL02525:Ros1 APN 10 52116042 missense possibly damaging 0.66
IGL02718:Ros1 APN 10 52118232 missense probably damaging 1.00
IGL02721:Ros1 APN 10 52172831 splice site probably benign
IGL02808:Ros1 APN 10 52125889 missense probably damaging 1.00
IGL03009:Ros1 APN 10 52145907 missense probably benign 0.00
IGL03035:Ros1 APN 10 52075984 splice site probably benign
IGL03092:Ros1 APN 10 52098806 missense probably damaging 0.99
IGL03309:Ros1 APN 10 52118261 missense possibly damaging 0.83
IGL03333:Ros1 APN 10 52155171 missense probably damaging 1.00
boss UTSW 10 52090995 nonsense probably null
Chuckwagon UTSW 10 52118203 missense probably damaging 1.00
trail UTSW 10 52161895 nonsense probably null
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0125:Ros1 UTSW 10 52125789 missense probably benign 0.38
R0403:Ros1 UTSW 10 52143438 splice site probably benign
R0487:Ros1 UTSW 10 52155108 missense possibly damaging 0.69
R0502:Ros1 UTSW 10 52194823 splice site probably benign
R0557:Ros1 UTSW 10 52085263 missense possibly damaging 0.82
R0599:Ros1 UTSW 10 52123300 missense probably damaging 1.00
R0620:Ros1 UTSW 10 52118348 missense probably damaging 1.00
R0679:Ros1 UTSW 10 52066295 missense possibly damaging 0.95
R1005:Ros1 UTSW 10 52128405 splice site probably benign
R1073:Ros1 UTSW 10 52046125 missense probably damaging 1.00
R1220:Ros1 UTSW 10 52098870 missense probably damaging 0.97
R1279:Ros1 UTSW 10 52142166 missense possibly damaging 0.81
R1295:Ros1 UTSW 10 52087932 missense possibly damaging 0.92
R1336:Ros1 UTSW 10 52168662 missense probably damaging 1.00
R1371:Ros1 UTSW 10 52087945 missense probably damaging 0.98
R1447:Ros1 UTSW 10 52098858 missense possibly damaging 0.66
R1486:Ros1 UTSW 10 52172858 missense probably damaging 1.00
R1499:Ros1 UTSW 10 52098677 missense possibly damaging 0.92
R1669:Ros1 UTSW 10 52161811 missense probably damaging 1.00
R1744:Ros1 UTSW 10 52123379 missense probably damaging 0.99
R1759:Ros1 UTSW 10 52120826 missense probably damaging 1.00
R1791:Ros1 UTSW 10 52100087 missense probably benign 0.00
R1794:Ros1 UTSW 10 52124103 nonsense probably null
R2031:Ros1 UTSW 10 52067068 missense possibly damaging 0.88
R2115:Ros1 UTSW 10 52128555 missense probably benign 0.00
R2219:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R2290:Ros1 UTSW 10 52118381 missense probably damaging 0.96
R2329:Ros1 UTSW 10 52162887 missense probably damaging 1.00
R2371:Ros1 UTSW 10 52163895 missense possibly damaging 0.66
R2879:Ros1 UTSW 10 52172840 critical splice donor site probably null
R3154:Ros1 UTSW 10 52050981 missense probably benign
R3423:Ros1 UTSW 10 52128416 splice site probably null
R3424:Ros1 UTSW 10 52128416 splice site probably null
R3425:Ros1 UTSW 10 52128416 splice site probably null
R3433:Ros1 UTSW 10 52091108 missense probably benign 0.45
R3522:Ros1 UTSW 10 52090995 nonsense probably null
R3686:Ros1 UTSW 10 52145816 missense probably damaging 1.00
R3710:Ros1 UTSW 10 52161895 nonsense probably null
R3771:Ros1 UTSW 10 52128991 missense probably damaging 0.97
R3808:Ros1 UTSW 10 52120848 missense probably benign 0.08
R3930:Ros1 UTSW 10 52194848 missense possibly damaging 0.92
R3950:Ros1 UTSW 10 52066388 missense probably damaging 1.00
R3981:Ros1 UTSW 10 52120878 missense possibly damaging 0.46
R4007:Ros1 UTSW 10 52118232 missense probably damaging 1.00
R4346:Ros1 UTSW 10 52168609 missense possibly damaging 0.92
R4382:Ros1 UTSW 10 52120959 missense possibly damaging 0.46
R4414:Ros1 UTSW 10 52162704 critical splice donor site probably null
R4450:Ros1 UTSW 10 52077942 missense probably damaging 0.98
R4468:Ros1 UTSW 10 52118356 missense probably damaging 1.00
R4569:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R4649:Ros1 UTSW 10 52129668 missense possibly damaging 0.66
R4684:Ros1 UTSW 10 52129096 missense probably damaging 1.00
R4706:Ros1 UTSW 10 52101894 missense possibly damaging 0.95
R4731:Ros1 UTSW 10 52142229 missense probably damaging 1.00
R4748:Ros1 UTSW 10 52115997 missense probably benign 0.00
R4806:Ros1 UTSW 10 52096175 missense probably damaging 0.96
R4973:Ros1 UTSW 10 52154991 missense probably damaging 0.98
R5022:Ros1 UTSW 10 52124075 missense possibly damaging 0.46
R5033:Ros1 UTSW 10 52128416 critical splice donor site probably null
R5082:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5083:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5130:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5269:Ros1 UTSW 10 52051008 missense probably damaging 1.00
R5399:Ros1 UTSW 10 52090944 critical splice donor site probably null
R5414:Ros1 UTSW 10 52155093 missense probably damaging 1.00
R5659:Ros1 UTSW 10 52143386 missense possibly damaging 0.92
R5742:Ros1 UTSW 10 52142138 critical splice donor site probably null
R5780:Ros1 UTSW 10 52194857 missense probably damaging 1.00
R5805:Ros1 UTSW 10 52123289 missense probably damaging 1.00
R5843:Ros1 UTSW 10 52166197 missense possibly damaging 0.92
R5881:Ros1 UTSW 10 52181798 missense probably benign 0.26
R6027:Ros1 UTSW 10 52163968 missense possibly damaging 0.82
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6052:Ros1 UTSW 10 52163903 missense probably benign 0.39
R6175:Ros1 UTSW 10 52101785 missense probably benign 0.02
R6315:Ros1 UTSW 10 52118210 missense probably benign
R6342:Ros1 UTSW 10 52155255 missense probably damaging 1.00
R6470:Ros1 UTSW 10 52166044 critical splice donor site probably null
R6527:Ros1 UTSW 10 52143377 missense possibly damaging 0.66
R6568:Ros1 UTSW 10 52162812 missense probably damaging 1.00
R6573:Ros1 UTSW 10 52155010 missense possibly damaging 0.84
R6653:Ros1 UTSW 10 52142203 missense probably damaging 1.00
R6959:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R7011:Ros1 UTSW 10 52180176 missense probably damaging 1.00
R7111:Ros1 UTSW 10 52181810 missense probably benign 0.02
R7243:Ros1 UTSW 10 52123381 missense probably damaging 1.00
R7355:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R7385:Ros1 UTSW 10 52155126 missense probably benign 0.00
R7460:Ros1 UTSW 10 52118203 missense probably damaging 1.00
R7549:Ros1 UTSW 10 52145834 missense probably damaging 0.96
R7573:Ros1 UTSW 10 52169976 missense probably benign 0.03
R7650:Ros1 UTSW 10 52046209 missense probably benign 0.00
R7667:Ros1 UTSW 10 52163971 missense probably damaging 1.00
R7696:Ros1 UTSW 10 52142283 missense probably damaging 1.00
R7785:Ros1 UTSW 10 52162848 missense probably damaging 1.00
R7814:Ros1 UTSW 10 52096137 missense probably benign 0.28
R7830:Ros1 UTSW 10 52154934 missense probably damaging 0.99
R7832:Ros1 UTSW 10 52144861 missense probably damaging 0.99
R7854:Ros1 UTSW 10 52128467 missense probably damaging 1.00
R7912:Ros1 UTSW 10 52168695 missense probably damaging 1.00
R7972:Ros1 UTSW 10 52154830 nonsense probably null
R7993:Ros1 UTSW 10 52123347 missense probably benign 0.34
R8036:Ros1 UTSW 10 52165343 missense probably benign
R8137:Ros1 UTSW 10 52125837 missense possibly damaging 0.87
R8169:Ros1 UTSW 10 52064672 critical splice donor site probably null
R8199:Ros1 UTSW 10 52101717 nonsense probably null
R8293:Ros1 UTSW 10 52087918 missense probably damaging 1.00
R8368:Ros1 UTSW 10 52064737 missense probably damaging 1.00
R8406:Ros1 UTSW 10 52101845 missense possibly damaging 0.56
RF018:Ros1 UTSW 10 52155121 missense probably benign
Z1176:Ros1 UTSW 10 52091109 missense possibly damaging 0.89
Z1177:Ros1 UTSW 10 52168671 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCATGGCCTTAGTATTTGAAATG -3'
(R):5'- GCCAAAACTACTGTGTGCC -3'

Sequencing Primer
(F):5'- GGCTGACCTTAAACTTGCTGCAG -3'
(R):5'- CCCCCAAACTTTTTGAGTAGCTAAGG -3'
Posted On2016-03-17