Incidental Mutation 'R4865:Ros1'
ID374846
Institutional Source Beutler Lab
Gene Symbol Ros1
Ensembl Gene ENSMUSG00000019893
Gene NameRos1 proto-oncogene
SynonymsRos-1, c-ros
MMRRC Submission 042475-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R4865 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location52045721-52195244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 52172870 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 88 (A88E)
Ref Sequence ENSEMBL: ENSMUSP00000151932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]
Predicted Effect probably damaging
Transcript: ENSMUST00000020045
AA Change: A97E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: A97E

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 568 654 2.24e-4 SMART
LY 734 776 2.28e1 SMART
LY 777 815 4.61e0 SMART
FN3 944 1023 5.53e-4 SMART
FN3 1037 1133 1.07e1 SMART
FN3 1440 1532 1.19e1 SMART
FN3 1551 1637 2.11e0 SMART
FN3 1649 1731 6.8e-4 SMART
FN3 1746 1832 2.7e1 SMART
TyrKc 1938 2208 1.3e-145 SMART
low complexity region 2294 2307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117992
AA Change: A97E

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: A97E

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
TyrKc 1917 2187 1.3e-145 SMART
low complexity region 2273 2286 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175892
AA Change: A88E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135235
Gene: ENSMUSG00000019893
AA Change: A88E

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 100 178 1.05e-4 SMART
FN3 196 273 7.45e-10 SMART
Blast:LY 360 400 1e-20 BLAST
Blast:LY 449 486 4e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000177378
AA Change: A97E

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: A97E

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
Blast:LY 1190 1236 2e-18 BLAST
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
transmembrane domain 1832 1854 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218452
AA Change: A97E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000219173
AA Change: A97E

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000219692
AA Change: A88E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.0902 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 C T 18: 61,805,086 V639M probably damaging Het
Adgrf4 A G 17: 42,667,265 S396P probably damaging Het
Aldh3b2 T A 19: 3,978,469 I123N probably damaging Het
Aldh5a1 A G 13: 24,911,584 Y517H probably damaging Het
Aph1c A C 9: 66,827,838 I77S probably damaging Het
Armc8 A G 9: 99,526,889 probably null Het
Atp13a5 G A 16: 29,248,160 P1020L probably damaging Het
BC024139 A T 15: 76,126,066 M80K possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cenpn A G 8: 116,934,773 I204V probably damaging Het
Ces4a A T 8: 105,147,158 M420L probably benign Het
Chdh T A 14: 30,033,724 D322E probably benign Het
Clcn6 A T 4: 148,019,766 I223N probably damaging Het
Clec4b1 A G 6: 123,068,469 K50E possibly damaging Het
Creg1 T A 1: 165,769,863 C135* probably null Het
Cyp4f13 C T 17: 32,925,704 R411Q probably damaging Het
Dnah7b T C 1: 46,195,074 F1426L probably damaging Het
Dock9 A T 14: 121,543,505 *1917R probably null Het
Dync1h1 T G 12: 110,639,801 L2435R possibly damaging Het
Eif3l C A 15: 79,081,649 Y166* probably null Het
Emilin1 T A 5: 30,917,784 N456K possibly damaging Het
Fam83f C T 15: 80,692,449 R434C probably damaging Het
Fbxw9 A G 8: 85,060,156 D10G possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fsip2 T G 2: 82,990,951 V5676G possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm11596 A G 11: 99,793,238 probably benign Het
Gm6522 T C 3: 106,275,970 noncoding transcript Het
Gm6728 A G 6: 136,487,074 noncoding transcript Het
Gria4 T A 9: 4,464,295 I556F possibly damaging Het
Grp A T 18: 65,879,970 D69V probably damaging Het
Gucy1a1 G T 3: 82,119,162 probably benign Het
Haus5 A T 7: 30,658,555 L376Q probably damaging Het
Ifne A T 4: 88,879,705 Y159N probably damaging Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Inpp5b T C 4: 124,751,495 V192A probably benign Het
Kcnh4 A G 11: 100,749,743 S486P probably damaging Het
Kif5b A G 18: 6,222,912 probably benign Het
Macf1 T A 4: 123,433,303 E4800D probably damaging Het
Mblac2 C T 13: 81,711,976 Q150* probably null Het
Mc1r A T 8: 123,407,516 T3S probably benign Het
Med17 G A 9: 15,265,372 Q70* probably null Het
Myocd A T 11: 65,179,030 probably null Het
Nphp3 T C 9: 104,031,970 L793P probably benign Het
Olfr1020 T A 2: 85,849,716 M88K probably damaging Het
Olfr1240 T G 2: 89,439,659 T207P possibly damaging Het
Olfr1377 A G 11: 50,985,543 T281A probably damaging Het
Olfr1436 T C 19: 12,298,580 D184G probably damaging Het
Olfr165 A T 16: 19,407,301 F238L probably damaging Het
Olfr891 T A 9: 38,179,900 T308S possibly damaging Het
Piezo1 A T 8: 122,486,921 L1745Q probably damaging Het
Prdm10 T A 9: 31,347,080 H600Q probably damaging Het
Psapl1 C A 5: 36,204,867 L268M probably damaging Het
Psg23 T C 7: 18,612,114 I219V probably benign Het
Rexo5 A T 7: 119,801,330 R113* probably null Het
Rgs22 A T 15: 36,100,212 I243N probably damaging Het
Rhbdf1 G A 11: 32,214,517 T183I probably damaging Het
Rhobtb1 T C 10: 69,270,724 M373T probably benign Het
Sdr16c6 A G 4: 4,058,834 F251L probably benign Het
Skil A G 3: 31,113,413 Y398C probably damaging Het
Slc22a3 A T 17: 12,464,532 M148K probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Sntn A T 14: 13,679,103 K92N probably benign Het
Spry4 A T 18: 38,589,823 S296T probably benign Het
St8sia1 A G 6: 142,829,070 F261S probably damaging Het
Stab2 C T 10: 86,843,500 probably null Het
Stk24 A T 14: 121,293,454 C363* probably null Het
Tank G A 2: 61,578,635 probably benign Het
Tmem67 T C 4: 12,070,262 N387S probably benign Het
Treml1 A T 17: 48,366,857 I304L probably benign Het
Trim13 A G 14: 61,605,517 I328V probably benign Het
Upk2 A G 9: 44,454,085 V62A probably damaging Het
Urb2 A T 8: 124,029,635 K694* probably null Het
Vmn2r17 C A 5: 109,427,119 N97K probably damaging Het
Vmn2r57 A T 7: 41,400,468 V619D probably damaging Het
Vmn2r92 G A 17: 18,167,372 R213Q probably benign Het
Wnt6 G A 1: 74,782,629 C123Y probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Zfp52 C T 17: 21,561,243 S451L probably damaging Het
Other mutations in Ros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ros1 APN 10 52194890 missense probably benign 0.01
IGL00338:Ros1 APN 10 52125811 missense probably benign
IGL00419:Ros1 APN 10 52091054 missense probably damaging 0.97
IGL00840:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00841:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00951:Ros1 APN 10 52143252 missense probably damaging 0.99
IGL01123:Ros1 APN 10 52120809 missense probably damaging 1.00
IGL01128:Ros1 APN 10 52142328 nonsense probably null
IGL01300:Ros1 APN 10 52101713 missense probably benign 0.01
IGL01316:Ros1 APN 10 52087879 critical splice donor site probably null
IGL01349:Ros1 APN 10 52051026 missense probably damaging 0.99
IGL01363:Ros1 APN 10 52166142 missense probably damaging 1.00
IGL01457:Ros1 APN 10 52046330 splice site probably benign
IGL01532:Ros1 APN 10 52090938 splice site probably benign
IGL01585:Ros1 APN 10 52155102 missense probably damaging 1.00
IGL01650:Ros1 APN 10 52154979 missense probably damaging 0.99
IGL01672:Ros1 APN 10 52101803 missense possibly damaging 0.92
IGL01904:Ros1 APN 10 52077911 missense probably damaging 0.97
IGL02040:Ros1 APN 10 52115922 missense probably damaging 0.99
IGL02053:Ros1 APN 10 52162720 missense probably damaging 1.00
IGL02147:Ros1 APN 10 52120895 missense probably damaging 1.00
IGL02169:Ros1 APN 10 52081957 critical splice donor site probably null
IGL02247:Ros1 APN 10 52129581 missense probably damaging 0.99
IGL02262:Ros1 APN 10 52178969 missense probably damaging 0.96
IGL02307:Ros1 APN 10 52128438 missense possibly damaging 0.53
IGL02398:Ros1 APN 10 52144884 splice site probably benign
IGL02525:Ros1 APN 10 52116042 missense possibly damaging 0.66
IGL02718:Ros1 APN 10 52118232 missense probably damaging 1.00
IGL02721:Ros1 APN 10 52172831 splice site probably benign
IGL02808:Ros1 APN 10 52125889 missense probably damaging 1.00
IGL03009:Ros1 APN 10 52145907 missense probably benign 0.00
IGL03035:Ros1 APN 10 52075984 splice site probably benign
IGL03092:Ros1 APN 10 52098806 missense probably damaging 0.99
IGL03309:Ros1 APN 10 52118261 missense possibly damaging 0.83
IGL03333:Ros1 APN 10 52155171 missense probably damaging 1.00
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0125:Ros1 UTSW 10 52125789 missense probably benign 0.38
R0403:Ros1 UTSW 10 52143438 splice site probably benign
R0487:Ros1 UTSW 10 52155108 missense possibly damaging 0.69
R0502:Ros1 UTSW 10 52194823 splice site probably benign
R0557:Ros1 UTSW 10 52085263 missense possibly damaging 0.82
R0599:Ros1 UTSW 10 52123300 missense probably damaging 1.00
R0620:Ros1 UTSW 10 52118348 missense probably damaging 1.00
R0679:Ros1 UTSW 10 52066295 missense possibly damaging 0.95
R1005:Ros1 UTSW 10 52128405 splice site probably benign
R1073:Ros1 UTSW 10 52046125 missense probably damaging 1.00
R1220:Ros1 UTSW 10 52098870 missense probably damaging 0.97
R1279:Ros1 UTSW 10 52142166 missense possibly damaging 0.81
R1295:Ros1 UTSW 10 52087932 missense possibly damaging 0.92
R1336:Ros1 UTSW 10 52168662 missense probably damaging 1.00
R1371:Ros1 UTSW 10 52087945 missense probably damaging 0.98
R1447:Ros1 UTSW 10 52098858 missense possibly damaging 0.66
R1486:Ros1 UTSW 10 52172858 missense probably damaging 1.00
R1499:Ros1 UTSW 10 52098677 missense possibly damaging 0.92
R1669:Ros1 UTSW 10 52161811 missense probably damaging 1.00
R1744:Ros1 UTSW 10 52123379 missense probably damaging 0.99
R1759:Ros1 UTSW 10 52120826 missense probably damaging 1.00
R1791:Ros1 UTSW 10 52100087 missense probably benign 0.00
R1794:Ros1 UTSW 10 52124103 nonsense probably null
R2031:Ros1 UTSW 10 52067068 missense possibly damaging 0.88
R2115:Ros1 UTSW 10 52128555 missense probably benign 0.00
R2219:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R2290:Ros1 UTSW 10 52118381 missense probably damaging 0.96
R2329:Ros1 UTSW 10 52162887 missense probably damaging 1.00
R2371:Ros1 UTSW 10 52163895 missense possibly damaging 0.66
R2879:Ros1 UTSW 10 52172840 critical splice donor site probably null
R3154:Ros1 UTSW 10 52050981 missense probably benign
R3423:Ros1 UTSW 10 52128416 unclassified probably null
R3424:Ros1 UTSW 10 52128416 unclassified probably null
R3425:Ros1 UTSW 10 52128416 unclassified probably null
R3433:Ros1 UTSW 10 52091108 missense probably benign 0.45
R3522:Ros1 UTSW 10 52090995 nonsense probably null
R3686:Ros1 UTSW 10 52145816 missense probably damaging 1.00
R3710:Ros1 UTSW 10 52161895 nonsense probably null
R3771:Ros1 UTSW 10 52128991 missense probably damaging 0.97
R3808:Ros1 UTSW 10 52120848 missense probably benign 0.08
R3930:Ros1 UTSW 10 52194848 missense possibly damaging 0.92
R3950:Ros1 UTSW 10 52066388 missense probably damaging 1.00
R3981:Ros1 UTSW 10 52120878 missense possibly damaging 0.46
R4007:Ros1 UTSW 10 52118232 missense probably damaging 1.00
R4346:Ros1 UTSW 10 52168609 missense possibly damaging 0.92
R4382:Ros1 UTSW 10 52120959 missense possibly damaging 0.46
R4414:Ros1 UTSW 10 52162704 critical splice donor site probably null
R4450:Ros1 UTSW 10 52077942 missense probably damaging 0.98
R4468:Ros1 UTSW 10 52118356 missense probably damaging 1.00
R4569:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R4649:Ros1 UTSW 10 52129668 missense possibly damaging 0.66
R4684:Ros1 UTSW 10 52129096 missense probably damaging 1.00
R4706:Ros1 UTSW 10 52101894 missense possibly damaging 0.95
R4731:Ros1 UTSW 10 52142229 missense probably damaging 1.00
R4748:Ros1 UTSW 10 52115997 missense probably benign 0.00
R4806:Ros1 UTSW 10 52096175 missense probably damaging 0.96
R4973:Ros1 UTSW 10 52154991 missense probably damaging 0.98
R5022:Ros1 UTSW 10 52124075 missense possibly damaging 0.46
R5033:Ros1 UTSW 10 52128416 critical splice donor site probably null
R5082:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5083:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5130:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5269:Ros1 UTSW 10 52051008 missense probably damaging 1.00
R5399:Ros1 UTSW 10 52090944 critical splice donor site probably null
R5414:Ros1 UTSW 10 52155093 missense probably damaging 1.00
R5659:Ros1 UTSW 10 52143386 missense possibly damaging 0.92
R5742:Ros1 UTSW 10 52142138 critical splice donor site probably null
R5780:Ros1 UTSW 10 52194857 missense probably damaging 1.00
R5805:Ros1 UTSW 10 52123289 missense probably damaging 1.00
R5843:Ros1 UTSW 10 52166197 missense possibly damaging 0.92
R5881:Ros1 UTSW 10 52181798 missense probably benign 0.26
R6027:Ros1 UTSW 10 52163968 missense possibly damaging 0.82
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6052:Ros1 UTSW 10 52163903 missense probably benign 0.39
R6175:Ros1 UTSW 10 52101785 missense probably benign 0.02
R6315:Ros1 UTSW 10 52118210 missense probably benign
R6342:Ros1 UTSW 10 52155255 missense probably damaging 1.00
R6470:Ros1 UTSW 10 52166044 critical splice donor site probably null
R6527:Ros1 UTSW 10 52143377 missense possibly damaging 0.66
R6568:Ros1 UTSW 10 52162812 missense probably damaging 1.00
R6573:Ros1 UTSW 10 52155010 missense possibly damaging 0.84
R6653:Ros1 UTSW 10 52142203 missense probably damaging 1.00
R6959:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R7011:Ros1 UTSW 10 52180176 missense probably damaging 1.00
R7111:Ros1 UTSW 10 52181810 missense probably benign 0.02
R7243:Ros1 UTSW 10 52123381 missense probably damaging 1.00
R7355:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R7385:Ros1 UTSW 10 52155126 missense probably benign 0.00
R7460:Ros1 UTSW 10 52118203 missense probably damaging 1.00
R7549:Ros1 UTSW 10 52145834 missense probably damaging 0.96
R7573:Ros1 UTSW 10 52169976 missense probably benign 0.03
R7650:Ros1 UTSW 10 52046209 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCATGGCCTTAGTATTTGAAATG -3'
(R):5'- GCCAAAACTACTGTGTGCC -3'

Sequencing Primer
(F):5'- GGCTGACCTTAAACTTGCTGCAG -3'
(R):5'- CCCCCAAACTTTTTGAGTAGCTAAGG -3'
Posted On2016-03-17