Mutagenetix > Incidental Mutation

Incidental Mutation 'R4865:Stab2'

374848

Institutional Source

Beutler Lab

Gene Symbol

Stab2

Ensembl Gene

ENSMUSG00000035459

Gene Name

stabilin 2

Synonyms

STAB-2, FEEL-2

MMRRC Submission

042475-MU

Accession Numbers

Genbank: NM_138673; MGI: 2178743

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4865 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86841198-87008025 bp(-) (GRCm38)

Type of Mutation

splice site (1 bp from exon)

DNA Base Change (assembly)

C to T at 86843500 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035288]

AlphaFold

Q8R4U0

Predicted Effect

probably null
Transcript: ENSMUST00000035288

SMART Domains

Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EGF	119	156	1.85e0	SMART
EGF	167	201	2.43e1	SMART
EGF	206	244	1.43e-1	SMART
EGF	248	284	3.82e-2	SMART
EGF	333	370	2.02e-1	SMART
FAS1	414	515	1.06e-8	SMART
FAS1	561	662	3.54e-19	SMART
EGF	746	783	6.76e-3	SMART
EGF	836	873	1.31e0	SMART
EGF	877	917	2.99e-4	SMART
EGF	921	960	3.51e-1	SMART
EGF	964	1002	1.99e0	SMART
FAS1	1038	1138	1.73e-13	SMART
FAS1	1181	1276	1.83e-12	SMART
EGF	1354	1391	6.92e0	SMART
EGF	1401	1435	1.11e1	SMART
EGF	1442	1477	3.01e0	SMART
EGF	1481	1519	1.64e-1	SMART
EGF	1523	1561	1.14e0	SMART
EGF	1565	1603	5.62e0	SMART
FAS1	1638	1734	2.23e-25	SMART
FAS1	1785	1891	6.92e-22	SMART
EGF	1966	2006	1.95e1	SMART
EGF_like	1977	2017	2.46e-1	SMART
EGF	2016	2050	1.14e0	SMART
EGF	2058	2089	1.56e1	SMART
EGF	2093	2130	1.36e1	SMART
EGF	2134	2173	2.13e0	SMART
LINK	2204	2298	2.08e-29	SMART
FAS1	2363	2455	3.19e-12	SMART
transmembrane domain	2467	2489	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159445

Predicted Effect

probably null
Transcript: ENSMUST00000161560

SMART Domains

Protein: ENSMUSP00000125263
Gene: ENSMUSG00000035459

Domain	Start	End	E-Value	Type
EGF	30	68	1.64e-1	SMART
EGF	72	110	1.14e0	SMART
EGF	114	152	5.62e0	SMART
FAS1	187	283	2.23e-25	SMART
FAS1	334	440	6.92e-22	SMART
EGF	515	555	1.95e1	SMART
EGF_like	526	566	2.46e-1	SMART
EGF	565	599	1.14e0	SMART
EGF	607	638	1.56e1	SMART
EGF	643	680	1.36e1	SMART
EGF	684	723	2.13e0	SMART
LINK	754	848	2.08e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000219341

Meta Mutation Damage Score

0.9460

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

98% (86/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim3	C	T	18: 61,805,086	V639M	probably damaging	Het
Adgrf4	A	G	17: 42,667,265	S396P	probably damaging	Het
Aldh3b2	T	A	19: 3,978,469	I123N	probably damaging	Het
Aldh5a1	A	G	13: 24,911,584	Y517H	probably damaging	Het
Aph1c	A	C	9: 66,827,838	I77S	probably damaging	Het
Armc8	A	G	9: 99,526,889		probably null	Het
Atp13a5	G	A	16: 29,248,160	P1020L	probably damaging	Het
BC024139	A	T	15: 76,126,066	M80K	possibly damaging	Het
Cdk5rap1	C	T	2: 154,370,956		probably null	Het
Cenpn	A	G	8: 116,934,773	I204V	probably damaging	Het
Ces4a	A	T	8: 105,147,158	M420L	probably benign	Het
Chdh	T	A	14: 30,033,724	D322E	probably benign	Het
Clcn6	A	T	4: 148,019,766	I223N	probably damaging	Het
Clec4b1	A	G	6: 123,068,469	K50E	possibly damaging	Het
Creg1	T	A	1: 165,769,863	C135*	probably null	Het
Cyp4f13	C	T	17: 32,925,704	R411Q	probably damaging	Het
Dnah7b	T	C	1: 46,195,074	F1426L	probably damaging	Het
Dock9	A	T	14: 121,543,505	*1917R	probably null	Het
Dync1h1	T	G	12: 110,639,801	L2435R	possibly damaging	Het
Eif3l	C	A	15: 79,081,649	Y166*	probably null	Het
Emilin1	T	A	5: 30,917,784	N456K	possibly damaging	Het
Fam83f	C	T	15: 80,692,449	R434C	probably damaging	Het
Fbxw9	A	G	8: 85,060,156	D10G	possibly damaging	Het
Flt1	C	A	5: 147,683,939	A132S	probably benign	Het
Fsip2	T	G	2: 82,990,951	V5676G	possibly damaging	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gm11596	A	G	11: 99,793,238		probably benign	Het
Gm6522	T	C	3: 106,275,970		noncoding transcript	Het
Gm6728	A	G	6: 136,487,074		noncoding transcript	Het
Gria4	T	A	9: 4,464,295	I556F	possibly damaging	Het
Grp	A	T	18: 65,879,970	D69V	probably damaging	Het
Gucy1a1	G	T	3: 82,119,162		probably benign	Het
Haus5	A	T	7: 30,658,555	L376Q	probably damaging	Het
Ifne	A	T	4: 88,879,705	Y159N	probably damaging	Het
Ift80	A	G	3: 68,990,759	V81A	probably benign	Het
Inpp5b	T	C	4: 124,751,495	V192A	probably benign	Het
Kcnh4	A	G	11: 100,749,743	S486P	probably damaging	Het
Kif5b	A	G	18: 6,222,912		probably benign	Het
Macf1	T	A	4: 123,433,303	E4800D	probably damaging	Het
Mblac2	C	T	13: 81,711,976	Q150*	probably null	Het
Mc1r	A	T	8: 123,407,516	T3S	probably benign	Het
Med17	G	A	9: 15,265,372	Q70*	probably null	Het
Myocd	A	T	11: 65,179,030		probably null	Het
Nphp3	T	C	9: 104,031,970	L793P	probably benign	Het
Olfr1020	T	A	2: 85,849,716	M88K	probably damaging	Het
Olfr1240	T	G	2: 89,439,659	T207P	possibly damaging	Het
Olfr1377	A	G	11: 50,985,543	T281A	probably damaging	Het
Olfr1436	T	C	19: 12,298,580	D184G	probably damaging	Het
Olfr165	A	T	16: 19,407,301	F238L	probably damaging	Het
Olfr891	T	A	9: 38,179,900	T308S	possibly damaging	Het
Piezo1	A	T	8: 122,486,921	L1745Q	probably damaging	Het
Prdm10	T	A	9: 31,347,080	H600Q	probably damaging	Het
Psapl1	C	A	5: 36,204,867	L268M	probably damaging	Het
Psg23	T	C	7: 18,612,114	I219V	probably benign	Het
Rexo5	A	T	7: 119,801,330	R113*	probably null	Het
Rgs22	A	T	15: 36,100,212	I243N	probably damaging	Het
Rhbdf1	G	A	11: 32,214,517	T183I	probably damaging	Het
Rhobtb1	T	C	10: 69,270,724	M373T	probably benign	Het
Ros1	G	T	10: 52,172,870	A88E	probably damaging	Het
Sdr16c6	A	G	4: 4,058,834	F251L	probably benign	Het
Skil	A	G	3: 31,113,413	Y398C	probably damaging	Het
Slc22a3	A	T	17: 12,464,532	M148K	probably benign	Het
Slco4c1	G	A	1: 96,841,228	P303L	probably damaging	Het
Sntn	A	T	14: 13,679,103	K92N	probably benign	Het
Spry4	A	T	18: 38,589,823	S296T	probably benign	Het
St8sia1	A	G	6: 142,829,070	F261S	probably damaging	Het
Stk24	A	T	14: 121,293,454	C363*	probably null	Het
Tank	G	A	2: 61,578,635		probably benign	Het
Tmem67	T	C	4: 12,070,262	N387S	probably benign	Het
Treml1	A	T	17: 48,366,857	I304L	probably benign	Het
Trim13	A	G	14: 61,605,517	I328V	probably benign	Het
Upk2	A	G	9: 44,454,085	V62A	probably damaging	Het
Urb2	A	T	8: 124,029,635	K694*	probably null	Het
Vmn2r17	C	A	5: 109,427,119	N97K	probably damaging	Het
Vmn2r57	A	T	7: 41,400,468	V619D	probably damaging	Het
Vmn2r92	G	A	17: 18,167,372	R213Q	probably benign	Het
Wnt6	G	A	1: 74,782,629	C123Y	probably damaging	Het
Zfp292	A	G	4: 34,819,563	I253T	probably damaging	Het
Zfp52	C	T	17: 21,561,243	S451L	probably damaging	Het

Other mutations in Stab2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Stab2	APN	10	86869206	splice site	probably null
IGL00809:Stab2	APN	10	86848174	splice site	probably benign
IGL00911:Stab2	APN	10	86969753	missense	probably damaging	1.00
IGL01347:Stab2	APN	10	86901703	splice site	probably null
IGL01411:Stab2	APN	10	86980008	splice site	probably benign
IGL01503:Stab2	APN	10	86940613	splice site	probably benign
IGL01599:Stab2	APN	10	86922895	missense	probably damaging	1.00
IGL01635:Stab2	APN	10	86981128	missense	probably benign	0.04
IGL01640:Stab2	APN	10	86954171	missense	probably benign	0.09
IGL01671:Stab2	APN	10	86969277	missense	possibly damaging	0.80
IGL02023:Stab2	APN	10	86871831	missense	possibly damaging	0.67
IGL02075:Stab2	APN	10	86967650	missense	possibly damaging	0.71
IGL02174:Stab2	APN	10	86859742	splice site	probably null
IGL02600:Stab2	APN	10	86954259	missense	probably damaging	1.00
IGL02666:Stab2	APN	10	86850902	missense	possibly damaging	0.67
IGL02668:Stab2	APN	10	86846163	splice site	probably benign
IGL02709:Stab2	APN	10	86846165	splice site	probably benign
IGL02728:Stab2	APN	10	86856556	missense	possibly damaging	0.95
IGL02803:Stab2	APN	10	86950269	splice site	probably benign
IGL02938:Stab2	APN	10	86871921	missense	possibly damaging	0.77
IGL03033:Stab2	APN	10	86996803	critical splice donor site	probably null
IGL03238:Stab2	APN	10	86855121	missense	probably damaging	1.00
IGL03402:Stab2	APN	10	86969301	missense	probably benign	0.03
prospector	UTSW	10	86901567	splice site	probably null
songbird	UTSW	10	86858152	missense	probably damaging	1.00
3-1:Stab2	UTSW	10	86869177	missense	probably damaging	0.96
F6893:Stab2	UTSW	10	86855171	missense	probably damaging	1.00
K7371:Stab2	UTSW	10	86943289	critical splice donor site	probably null
PIT4142001:Stab2	UTSW	10	86867175	missense	possibly damaging	0.94
PIT4362001:Stab2	UTSW	10	86861435	nonsense	probably null
R0015:Stab2	UTSW	10	86843617	missense	probably benign
R0254:Stab2	UTSW	10	86897960	missense	probably benign
R0310:Stab2	UTSW	10	86967613	splice site	probably benign
R0333:Stab2	UTSW	10	86841627	missense	probably benign
R0391:Stab2	UTSW	10	86947144	missense	probably benign	0.27
R0400:Stab2	UTSW	10	86872610	missense	probably damaging	1.00
R0433:Stab2	UTSW	10	86843491	splice site	probably benign
R0440:Stab2	UTSW	10	86949928	missense	probably benign	0.23
R0743:Stab2	UTSW	10	86887895	missense	probably damaging	1.00
R0847:Stab2	UTSW	10	86969871	missense	probably benign	0.00
R0883:Stab2	UTSW	10	86924450	splice site	probably benign
R1078:Stab2	UTSW	10	86907133	splice site	probably null
R1118:Stab2	UTSW	10	86885718	splice site	probably null
R1119:Stab2	UTSW	10	86859755	missense	possibly damaging	0.51
R1179:Stab2	UTSW	10	86950301	missense	probably damaging	0.98
R1440:Stab2	UTSW	10	86861367	splice site	probably null
R1550:Stab2	UTSW	10	86878926	missense	probably benign	0.01
R1616:Stab2	UTSW	10	86885718	splice site	probably null
R1728:Stab2	UTSW	10	86938039	missense	probably benign	0.41
R1768:Stab2	UTSW	10	87003008	missense	probably damaging	1.00
R1772:Stab2	UTSW	10	86954234	missense	probably benign	0.06
R1776:Stab2	UTSW	10	86957816	missense	possibly damaging	0.92
R1784:Stab2	UTSW	10	86938039	missense	probably benign	0.41
R1892:Stab2	UTSW	10	86938049	missense	probably damaging	0.99
R1957:Stab2	UTSW	10	86861470	missense	probably benign	0.13
R1972:Stab2	UTSW	10	86960316	missense	probably damaging	0.99
R1975:Stab2	UTSW	10	86896496	critical splice donor site	probably null
R1976:Stab2	UTSW	10	86896496	critical splice donor site	probably null
R1996:Stab2	UTSW	10	87003031	missense	probably damaging	1.00
R2085:Stab2	UTSW	10	86954159	missense	probably damaging	1.00
R2149:Stab2	UTSW	10	86865040	nonsense	probably null
R2169:Stab2	UTSW	10	86887862	missense	probably damaging	1.00
R2201:Stab2	UTSW	10	86940639	missense	probably benign	0.22
R2296:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2297:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2298:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2326:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2434:Stab2	UTSW	10	86969319	missense	possibly damaging	0.78
R2519:Stab2	UTSW	10	86934840	splice site	probably benign
R2696:Stab2	UTSW	10	86861499	missense	probably benign	0.45
R2883:Stab2	UTSW	10	86967686	missense	possibly damaging	0.92
R2923:Stab2	UTSW	10	86861461	missense	probably damaging	1.00
R3711:Stab2	UTSW	10	86866708	missense	probably damaging	1.00
R3787:Stab2	UTSW	10	86969277	missense	possibly damaging	0.50
R3834:Stab2	UTSW	10	86949912	missense	possibly damaging	0.87
R3970:Stab2	UTSW	10	86878886	missense	probably damaging	0.97
R3979:Stab2	UTSW	10	86863456	missense	possibly damaging	0.56
R4003:Stab2	UTSW	10	86858124	missense	probably damaging	1.00
R4088:Stab2	UTSW	10	86922185	missense	probably damaging	1.00
R4151:Stab2	UTSW	10	87002983	missense	probably benign	0.12
R4190:Stab2	UTSW	10	86878944	missense	probably damaging	0.98
R4556:Stab2	UTSW	10	86967679	missense	possibly damaging	0.95
R4773:Stab2	UTSW	10	86907371	nonsense	probably null
R4825:Stab2	UTSW	10	86947147	missense	probably benign	0.08
R4871:Stab2	UTSW	10	86942235	missense	probably damaging	0.99
R4943:Stab2	UTSW	10	86954162	missense	probably damaging	0.99
R4981:Stab2	UTSW	10	86960223	missense	probably benign
R4994:Stab2	UTSW	10	86949907	missense	probably benign
R4999:Stab2	UTSW	10	86937909	missense	probably damaging	0.97
R5061:Stab2	UTSW	10	86907385	missense	probably damaging	1.00
R5072:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5073:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5074:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5134:Stab2	UTSW	10	86871810	splice site	probably null
R5213:Stab2	UTSW	10	86907197	missense	probably damaging	0.99
R5508:Stab2	UTSW	10	86960279	missense	probably benign	0.01
R5530:Stab2	UTSW	10	86947162	missense	probably benign	0.04
R5540:Stab2	UTSW	10	86848125	missense	probably benign	0.30
R5839:Stab2	UTSW	10	86872691	missense	probably damaging	0.97
R5949:Stab2	UTSW	10	86969849	missense	possibly damaging	0.87
R6015:Stab2	UTSW	10	86938042	missense	probably damaging	0.99
R6019:Stab2	UTSW	10	87003022	missense	probably benign	0.00
R6116:Stab2	UTSW	10	86907190	missense	probably damaging	1.00
R6131:Stab2	UTSW	10	86883778	splice site	probably null
R6209:Stab2	UTSW	10	86923003	missense	possibly damaging	0.94
R6243:Stab2	UTSW	10	86907161	missense	probably damaging	1.00
R6433:Stab2	UTSW	10	86901567	splice site	probably null
R6787:Stab2	UTSW	10	86919084	missense	probably benign	0.07
R6841:Stab2	UTSW	10	86942190	missense	probably damaging	1.00
R6873:Stab2	UTSW	10	86861366	critical splice donor site	probably null
R7025:Stab2	UTSW	10	86850837	missense	probably damaging	1.00
R7043:Stab2	UTSW	10	86870246	missense	probably damaging	0.99
R7047:Stab2	UTSW	10	86858152	missense	probably damaging	1.00
R7107:Stab2	UTSW	10	86905592	missense	possibly damaging	0.96
R7214:Stab2	UTSW	10	86899841	missense	probably damaging	0.99
R7271:Stab2	UTSW	10	87003108	splice site	probably null
R7291:Stab2	UTSW	10	86946220	missense	probably damaging	0.96
R7336:Stab2	UTSW	10	86969185	nonsense	probably null
R7432:Stab2	UTSW	10	86885683	missense	probably damaging	0.99
R7580:Stab2	UTSW	10	86869164	missense	probably benign	0.00
R7622:Stab2	UTSW	10	86873902	missense	possibly damaging	0.65
R7629:Stab2	UTSW	10	86883782	critical splice donor site	probably null
R7658:Stab2	UTSW	10	86981135	missense	probably benign	0.12
R7798:Stab2	UTSW	10	86957912	missense	probably damaging	0.98
R7835:Stab2	UTSW	10	86872619	missense	probably benign	0.06
R7845:Stab2	UTSW	10	86996894	missense	probably benign	0.09
R7863:Stab2	UTSW	10	86972881	missense	probably benign	0.30
R7885:Stab2	UTSW	10	86878912	missense	probably benign	0.03
R7904:Stab2	UTSW	10	86954192	nonsense	probably null
R7947:Stab2	UTSW	10	86846033	missense	probably benign	0.31
R7963:Stab2	UTSW	10	86848023	critical splice donor site	probably null
R8014:Stab2	UTSW	10	86850903	missense	possibly damaging	0.78
R8021:Stab2	UTSW	10	86905539	missense	possibly damaging	0.69
R8024:Stab2	UTSW	10	86846052	missense	probably benign	0.34
R8097:Stab2	UTSW	10	86869095	missense	possibly damaging	0.86
R8281:Stab2	UTSW	10	86873864	missense	probably damaging	0.98
R8462:Stab2	UTSW	10	86967734	missense	possibly damaging	0.79
R8670:Stab2	UTSW	10	86940723	missense	probably damaging	1.00
R8692:Stab2	UTSW	10	86972930	missense	probably damaging	0.99
R8744:Stab2	UTSW	10	86969349	missense	probably benign	0.32
R8745:Stab2	UTSW	10	86969349	missense	probably benign	0.32
R8782:Stab2	UTSW	10	86899821	missense	probably benign	0.00
R8875:Stab2	UTSW	10	86996864	missense	probably damaging	1.00
R8978:Stab2	UTSW	10	86949918	missense	possibly damaging	0.64
R9141:Stab2	UTSW	10	86869047	missense	probably damaging	1.00
R9248:Stab2	UTSW	10	86891617	missense	probably damaging	0.98
R9326:Stab2	UTSW	10	86955146	missense	probably damaging	1.00
R9426:Stab2	UTSW	10	86869047	missense	probably damaging	1.00
R9568:Stab2	UTSW	10	86863556	missense	probably damaging	1.00
R9627:Stab2	UTSW	10	86957840	missense	probably damaging	0.98
R9635:Stab2	UTSW	10	86850787	nonsense	probably null
R9648:Stab2	UTSW	10	86856697	frame shift	probably null
R9649:Stab2	UTSW	10	86856697	frame shift	probably null
R9650:Stab2	UTSW	10	86856697	frame shift	probably null
R9726:Stab2	UTSW	10	86954231	missense	probably benign	0.00
R9756:Stab2	UTSW	10	86967689	missense	possibly damaging	0.50
R9786:Stab2	UTSW	10	86922133	missense	probably benign	0.03
RF061:Stab2	UTSW	10	86866758	critical splice acceptor site	probably benign
X0023:Stab2	UTSW	10	86922198	critical splice acceptor site	probably null
X0025:Stab2	UTSW	10	86887816	missense	probably damaging	1.00
Z1176:Stab2	UTSW	10	86949914	missense	probably damaging	0.99
Z1177:Stab2	UTSW	10	86896596	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCATCTCCCCGAAAAGATG -3'
(R):5'- AGTGCCTTCTCTCACAAGTCAG -3'

Sequencing Primer
(F):5'- CCGAAAAGATGGGGATTCTGATC -3'
(R):5'- CAAGTCAGTCATCTCAACAGTGTTGC -3'

Posted On

2016-03-17