Incidental Mutation 'R4865:Trim13'
ID 374860
Institutional Source Beutler Lab
Gene Symbol Trim13
Ensembl Gene ENSMUSG00000035235
Gene Name tripartite motif-containing 13
Synonyms LEU5, RNF77, Rfp2, 3110001L12Rik
MMRRC Submission 042475-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4865 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 61598247-61605946 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 61605517 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 328 (I328V)
Ref Sequence ENSEMBL: ENSMUSP00000128509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039562] [ENSMUST00000051184] [ENSMUST00000165015] [ENSMUST00000225582]
AlphaFold Q9CYB0
Predicted Effect probably benign
Transcript: ENSMUST00000039562
AA Change: I328V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045009
Gene: ENSMUSG00000035235
AA Change: I328V

DomainStartEndE-ValueType
RING 10 57 1.31e-8 SMART
BBOX 89 131 5.55e-12 SMART
transmembrane domain 316 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051184
SMART Domains Protein: ENSMUSP00000055327
Gene: ENSMUSG00000046168

DomainStartEndE-ValueType
BTB 5 106 8.7e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165015
AA Change: I328V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128509
Gene: ENSMUSG00000035235
AA Change: I328V

DomainStartEndE-ValueType
RING 10 57 1.31e-8 SMART
BBOX 89 131 5.55e-12 SMART
transmembrane domain 316 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183066
Predicted Effect probably benign
Transcript: ENSMUST00000225582
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This gene is located on chromosome 13 within the minimal deletion region for B-cell chronic lymphocytic leukemia. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 C T 18: 61,805,086 V639M probably damaging Het
Adgrf4 A G 17: 42,667,265 S396P probably damaging Het
Aldh3b2 T A 19: 3,978,469 I123N probably damaging Het
Aldh5a1 A G 13: 24,911,584 Y517H probably damaging Het
Aph1c A C 9: 66,827,838 I77S probably damaging Het
Armc8 A G 9: 99,526,889 probably null Het
Atp13a5 G A 16: 29,248,160 P1020L probably damaging Het
BC024139 A T 15: 76,126,066 M80K possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cenpn A G 8: 116,934,773 I204V probably damaging Het
Ces4a A T 8: 105,147,158 M420L probably benign Het
Chdh T A 14: 30,033,724 D322E probably benign Het
Clcn6 A T 4: 148,019,766 I223N probably damaging Het
Clec4b1 A G 6: 123,068,469 K50E possibly damaging Het
Creg1 T A 1: 165,769,863 C135* probably null Het
Cyp4f13 C T 17: 32,925,704 R411Q probably damaging Het
Dnah7b T C 1: 46,195,074 F1426L probably damaging Het
Dock9 A T 14: 121,543,505 *1917R probably null Het
Dync1h1 T G 12: 110,639,801 L2435R possibly damaging Het
Eif3l C A 15: 79,081,649 Y166* probably null Het
Emilin1 T A 5: 30,917,784 N456K possibly damaging Het
Fam83f C T 15: 80,692,449 R434C probably damaging Het
Fbxw9 A G 8: 85,060,156 D10G possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fsip2 T G 2: 82,990,951 V5676G possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm11596 A G 11: 99,793,238 probably benign Het
Gm6522 T C 3: 106,275,970 noncoding transcript Het
Gm6728 A G 6: 136,487,074 noncoding transcript Het
Gria4 T A 9: 4,464,295 I556F possibly damaging Het
Grp A T 18: 65,879,970 D69V probably damaging Het
Gucy1a1 G T 3: 82,119,162 probably benign Het
Haus5 A T 7: 30,658,555 L376Q probably damaging Het
Ifne A T 4: 88,879,705 Y159N probably damaging Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Inpp5b T C 4: 124,751,495 V192A probably benign Het
Kcnh4 A G 11: 100,749,743 S486P probably damaging Het
Kif5b A G 18: 6,222,912 probably benign Het
Macf1 T A 4: 123,433,303 E4800D probably damaging Het
Mblac2 C T 13: 81,711,976 Q150* probably null Het
Mc1r A T 8: 123,407,516 T3S probably benign Het
Med17 G A 9: 15,265,372 Q70* probably null Het
Myocd A T 11: 65,179,030 probably null Het
Nphp3 T C 9: 104,031,970 L793P probably benign Het
Olfr1020 T A 2: 85,849,716 M88K probably damaging Het
Olfr1240 T G 2: 89,439,659 T207P possibly damaging Het
Olfr1377 A G 11: 50,985,543 T281A probably damaging Het
Olfr1436 T C 19: 12,298,580 D184G probably damaging Het
Olfr165 A T 16: 19,407,301 F238L probably damaging Het
Olfr891 T A 9: 38,179,900 T308S possibly damaging Het
Piezo1 A T 8: 122,486,921 L1745Q probably damaging Het
Prdm10 T A 9: 31,347,080 H600Q probably damaging Het
Psapl1 C A 5: 36,204,867 L268M probably damaging Het
Psg23 T C 7: 18,612,114 I219V probably benign Het
Rexo5 A T 7: 119,801,330 R113* probably null Het
Rgs22 A T 15: 36,100,212 I243N probably damaging Het
Rhbdf1 G A 11: 32,214,517 T183I probably damaging Het
Rhobtb1 T C 10: 69,270,724 M373T probably benign Het
Ros1 G T 10: 52,172,870 A88E probably damaging Het
Sdr16c6 A G 4: 4,058,834 F251L probably benign Het
Skil A G 3: 31,113,413 Y398C probably damaging Het
Slc22a3 A T 17: 12,464,532 M148K probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Sntn A T 14: 13,679,103 K92N probably benign Het
Spry4 A T 18: 38,589,823 S296T probably benign Het
St8sia1 A G 6: 142,829,070 F261S probably damaging Het
Stab2 C T 10: 86,843,500 probably null Het
Stk24 A T 14: 121,293,454 C363* probably null Het
Tank G A 2: 61,578,635 probably benign Het
Tmem67 T C 4: 12,070,262 N387S probably benign Het
Treml1 A T 17: 48,366,857 I304L probably benign Het
Upk2 A G 9: 44,454,085 V62A probably damaging Het
Urb2 A T 8: 124,029,635 K694* probably null Het
Vmn2r17 C A 5: 109,427,119 N97K probably damaging Het
Vmn2r57 A T 7: 41,400,468 V619D probably damaging Het
Vmn2r92 G A 17: 18,167,372 R213Q probably benign Het
Wnt6 G A 1: 74,782,629 C123Y probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Zfp52 C T 17: 21,561,243 S451L probably damaging Het
Other mutations in Trim13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Trim13 APN 14 61605670 missense probably benign
IGL00811:Trim13 APN 14 61604857 splice site probably null
IGL01760:Trim13 APN 14 61605723 missense probably benign 0.06
IGL02411:Trim13 APN 14 61605149 missense probably damaging 1.00
IGL02625:Trim13 APN 14 61605550 missense probably benign 0.00
IGL02926:Trim13 APN 14 61605244 splice site probably null
IGL03231:Trim13 APN 14 61605545 missense probably benign 0.11
R0089:Trim13 UTSW 14 61604717 missense possibly damaging 0.95
R0811:Trim13 UTSW 14 61605700 missense probably benign
R0812:Trim13 UTSW 14 61605700 missense probably benign
R1515:Trim13 UTSW 14 61605659 missense probably benign 0.03
R1778:Trim13 UTSW 14 61605619 missense probably benign 0.13
R2018:Trim13 UTSW 14 61604886 nonsense probably null
R2019:Trim13 UTSW 14 61604886 nonsense probably null
R5456:Trim13 UTSW 14 61605074 missense possibly damaging 0.91
R5860:Trim13 UTSW 14 61604739 missense probably damaging 0.96
R5921:Trim13 UTSW 14 61605089 missense probably benign 0.00
R7026:Trim13 UTSW 14 61605113 nonsense probably null
R7147:Trim13 UTSW 14 61604631 missense probably damaging 1.00
R8461:Trim13 UTSW 14 61605472 missense probably benign
R9181:Trim13 UTSW 14 61604597 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGAAACTCCTTTGCCACACTC -3'
(R):5'- CCACATTGTTCAGTGCCAC -3'

Sequencing Primer
(F):5'- CTAATTTGCCCACAAGCCCTTTAATG -3'
(R):5'- ATTGTTCAGTGCCACCAAAC -3'
Posted On 2016-03-17