Mutagenetix > Incidental Mutations

Incidental Mutation 'R4865:Trim13'

374860

Institutional Source

Beutler Lab

Gene Symbol

Trim13

Ensembl Gene

ENSMUSG00000035235

Gene Name

tripartite motif-containing 13

Synonyms

LEU5, RNF77, Rfp2, 3110001L12Rik

MMRRC Submission

042475-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4865 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61598247-61605946 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 61605517 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 328 (I328V)

Ref Sequence

ENSEMBL: ENSMUSP00000128509 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039562] [ENSMUST00000051184] [ENSMUST00000165015] [ENSMUST00000225582]

Predicted Effect

probably benign
Transcript: ENSMUST00000039562
AA Change: I328V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000045009
Gene: ENSMUSG00000035235
AA Change: I328V

Domain	Start	End	E-Value	Type
RING	10	57	1.31e-8	SMART
BBOX	89	131	5.55e-12	SMART
transmembrane domain	316	338	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000051184

SMART Domains

Protein: ENSMUSP00000055327
Gene: ENSMUSG00000046168

Domain	Start	End	E-Value	Type
BTB	5	106	8.7e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165015
AA Change: I328V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000128509
Gene: ENSMUSG00000035235
AA Change: I328V

Domain	Start	End	E-Value	Type
RING	10	57	1.31e-8	SMART
BBOX	89	131	5.55e-12	SMART
transmembrane domain	316	338	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182259

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182325

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182768

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183054

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183066

Predicted Effect

probably benign
Transcript: ENSMUST00000225582

Meta Mutation Damage Score

0.0697

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

98% (86/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This gene is located on chromosome 13 within the minimal deletion region for B-cell chronic lymphocytic leukemia. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim3	C	T	18: 61,805,086	V639M	probably damaging	Het
Adgrf4	A	G	17: 42,667,265	S396P	probably damaging	Het
Aldh3b2	T	A	19: 3,978,469	I123N	probably damaging	Het
Aldh5a1	A	G	13: 24,911,584	Y517H	probably damaging	Het
Aph1c	A	C	9: 66,827,838	I77S	probably damaging	Het
Armc8	A	G	9: 99,526,889		probably null	Het
Atp13a5	G	A	16: 29,248,160	P1020L	probably damaging	Het
BC024139	A	T	15: 76,126,066	M80K	possibly damaging	Het
Cdk5rap1	C	T	2: 154,370,956		probably null	Het
Cenpn	A	G	8: 116,934,773	I204V	probably damaging	Het
Ces4a	A	T	8: 105,147,158	M420L	probably benign	Het
Chdh	T	A	14: 30,033,724	D322E	probably benign	Het
Clcn6	A	T	4: 148,019,766	I223N	probably damaging	Het
Clec4b1	A	G	6: 123,068,469	K50E	possibly damaging	Het
Creg1	T	A	1: 165,769,863	C135*	probably null	Het
Cyp4f13	C	T	17: 32,925,704	R411Q	probably damaging	Het
Dnah7b	T	C	1: 46,195,074	F1426L	probably damaging	Het
Dock9	A	T	14: 121,543,505	*1917R	probably null	Het
Dync1h1	T	G	12: 110,639,801	L2435R	possibly damaging	Het
Eif3l	C	A	15: 79,081,649	Y166*	probably null	Het
Emilin1	T	A	5: 30,917,784	N456K	possibly damaging	Het
Fam83f	C	T	15: 80,692,449	R434C	probably damaging	Het
Fbxw9	A	G	8: 85,060,156	D10G	possibly damaging	Het
Flt1	C	A	5: 147,683,939	A132S	probably benign	Het
Fsip2	T	G	2: 82,990,951	V5676G	possibly damaging	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gm11596	A	G	11: 99,793,238		probably benign	Het
Gm6522	T	C	3: 106,275,970		noncoding transcript	Het
Gm6728	A	G	6: 136,487,074		noncoding transcript	Het
Gria4	T	A	9: 4,464,295	I556F	possibly damaging	Het
Grp	A	T	18: 65,879,970	D69V	probably damaging	Het
Gucy1a1	G	T	3: 82,119,162		probably benign	Het
Haus5	A	T	7: 30,658,555	L376Q	probably damaging	Het
Ifne	A	T	4: 88,879,705	Y159N	probably damaging	Het
Ift80	A	G	3: 68,990,759	V81A	probably benign	Het
Inpp5b	T	C	4: 124,751,495	V192A	probably benign	Het
Kcnh4	A	G	11: 100,749,743	S486P	probably damaging	Het
Kif5b	A	G	18: 6,222,912		probably benign	Het
Macf1	T	A	4: 123,433,303	E4800D	probably damaging	Het
Mblac2	C	T	13: 81,711,976	Q150*	probably null	Het
Mc1r	A	T	8: 123,407,516	T3S	probably benign	Het
Med17	G	A	9: 15,265,372	Q70*	probably null	Het
Myocd	A	T	11: 65,179,030		probably null	Het
Nphp3	T	C	9: 104,031,970	L793P	probably benign	Het
Olfr1020	T	A	2: 85,849,716	M88K	probably damaging	Het
Olfr1240	T	G	2: 89,439,659	T207P	possibly damaging	Het
Olfr1377	A	G	11: 50,985,543	T281A	probably damaging	Het
Olfr1436	T	C	19: 12,298,580	D184G	probably damaging	Het
Olfr165	A	T	16: 19,407,301	F238L	probably damaging	Het
Olfr891	T	A	9: 38,179,900	T308S	possibly damaging	Het
Piezo1	A	T	8: 122,486,921	L1745Q	probably damaging	Het
Prdm10	T	A	9: 31,347,080	H600Q	probably damaging	Het
Psapl1	C	A	5: 36,204,867	L268M	probably damaging	Het
Psg23	T	C	7: 18,612,114	I219V	probably benign	Het
Rexo5	A	T	7: 119,801,330	R113*	probably null	Het
Rgs22	A	T	15: 36,100,212	I243N	probably damaging	Het
Rhbdf1	G	A	11: 32,214,517	T183I	probably damaging	Het
Rhobtb1	T	C	10: 69,270,724	M373T	probably benign	Het
Ros1	G	T	10: 52,172,870	A88E	probably damaging	Het
Sdr16c6	A	G	4: 4,058,834	F251L	probably benign	Het
Skil	A	G	3: 31,113,413	Y398C	probably damaging	Het
Slc22a3	A	T	17: 12,464,532	M148K	probably benign	Het
Slco4c1	G	A	1: 96,841,228	P303L	probably damaging	Het
Sntn	A	T	14: 13,679,103	K92N	probably benign	Het
Spry4	A	T	18: 38,589,823	S296T	probably benign	Het
St8sia1	A	G	6: 142,829,070	F261S	probably damaging	Het
Stab2	C	T	10: 86,843,500		probably null	Het
Stk24	A	T	14: 121,293,454	C363*	probably null	Het
Tank	G	A	2: 61,578,635		probably benign	Het
Tmem67	T	C	4: 12,070,262	N387S	probably benign	Het
Treml1	A	T	17: 48,366,857	I304L	probably benign	Het
Upk2	A	G	9: 44,454,085	V62A	probably damaging	Het
Urb2	A	T	8: 124,029,635	K694*	probably null	Het
Vmn2r17	C	A	5: 109,427,119	N97K	probably damaging	Het
Vmn2r57	A	T	7: 41,400,468	V619D	probably damaging	Het
Vmn2r92	G	A	17: 18,167,372	R213Q	probably benign	Het
Wnt6	G	A	1: 74,782,629	C123Y	probably damaging	Het
Zfp292	A	G	4: 34,819,563	I253T	probably damaging	Het
Zfp52	C	T	17: 21,561,243	S451L	probably damaging	Het

Other mutations in Trim13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Trim13	APN	14	61605670	missense	probably benign
IGL00811:Trim13	APN	14	61604857	splice site	probably null
IGL01760:Trim13	APN	14	61605723	missense	probably benign	0.06
IGL02411:Trim13	APN	14	61605149	missense	probably damaging	1.00
IGL02625:Trim13	APN	14	61605550	missense	probably benign	0.00
IGL02926:Trim13	APN	14	61605244	splice site	probably null
IGL03231:Trim13	APN	14	61605545	missense	probably benign	0.11
R0089:Trim13	UTSW	14	61604717	missense	possibly damaging	0.95
R0811:Trim13	UTSW	14	61605700	missense	probably benign
R0812:Trim13	UTSW	14	61605700	missense	probably benign
R1515:Trim13	UTSW	14	61605659	missense	probably benign	0.03
R1778:Trim13	UTSW	14	61605619	missense	probably benign	0.13
R2018:Trim13	UTSW	14	61604886	nonsense	probably null
R2019:Trim13	UTSW	14	61604886	nonsense	probably null
R5456:Trim13	UTSW	14	61605074	missense	possibly damaging	0.91
R5860:Trim13	UTSW	14	61604739	missense	probably damaging	0.96
R5921:Trim13	UTSW	14	61605089	missense	probably benign	0.00
R7026:Trim13	UTSW	14	61605113	nonsense	probably null
R7147:Trim13	UTSW	14	61604631	missense	probably damaging	1.00
R8461:Trim13	UTSW	14	61605472	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGAAACTCCTTTGCCACACTC -3'
(R):5'- CCACATTGTTCAGTGCCAC -3'

Sequencing Primer
(F):5'- CTAATTTGCCCACAAGCCCTTTAATG -3'
(R):5'- ATTGTTCAGTGCCACCAAAC -3'

Posted On

2016-03-17