Incidental Mutation 'R4865:Ablim3'
ID374877
Institutional Source Beutler Lab
Gene Symbol Ablim3
Ensembl Gene ENSMUSG00000032735
Gene Nameactin binding LIM protein family, member 3
SynonymsD930036B08Rik
MMRRC Submission 042475-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4865 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location61799395-61911852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61805086 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 639 (V639M)
Ref Sequence ENSEMBL: ENSMUSP00000125836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049378] [ENSMUST00000166783]
Predicted Effect probably damaging
Transcript: ENSMUST00000049378
AA Change: V639M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041243
Gene: ENSMUSG00000032735
AA Change: V639M

DomainStartEndE-ValueType
LIM 22 73 4.19e-8 SMART
LIM 81 133 2.31e-10 SMART
LIM 150 201 2.4e-17 SMART
LIM 209 261 1.12e-8 SMART
Pfam:AbLIM_anchor 273 646 6.5e-154 PFAM
VHP 647 682 1.66e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166783
AA Change: V639M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125836
Gene: ENSMUSG00000032735
AA Change: V639M

DomainStartEndE-ValueType
LIM 22 73 4.19e-8 SMART
LIM 81 133 2.31e-10 SMART
LIM 150 201 2.4e-17 SMART
LIM 209 261 1.12e-8 SMART
Pfam:AbLIM_anchor 273 646 6.5e-154 PFAM
VHP 647 682 1.66e-19 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the actin-binding LIM (abLIM) family of proteins. These proteins are characterized by an N-terminal LIM domain and a C-terminal dematin-like domain. The encoded protein interacts with actin filaments and may be a component of adherens junctions in several cell types. A variant of this gene may be associated with pain sensitivity in male human patients. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf4 A G 17: 42,667,265 S396P probably damaging Het
Aldh3b2 T A 19: 3,978,469 I123N probably damaging Het
Aldh5a1 A G 13: 24,911,584 Y517H probably damaging Het
Aph1c A C 9: 66,827,838 I77S probably damaging Het
Armc8 A G 9: 99,526,889 probably null Het
Atp13a5 G A 16: 29,248,160 P1020L probably damaging Het
BC024139 A T 15: 76,126,066 M80K possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cenpn A G 8: 116,934,773 I204V probably damaging Het
Ces4a A T 8: 105,147,158 M420L probably benign Het
Chdh T A 14: 30,033,724 D322E probably benign Het
Clcn6 A T 4: 148,019,766 I223N probably damaging Het
Clec4b1 A G 6: 123,068,469 K50E possibly damaging Het
Creg1 T A 1: 165,769,863 C135* probably null Het
Cyp4f13 C T 17: 32,925,704 R411Q probably damaging Het
Dnah7b T C 1: 46,195,074 F1426L probably damaging Het
Dock9 A T 14: 121,543,505 *1917R probably null Het
Dync1h1 T G 12: 110,639,801 L2435R possibly damaging Het
Eif3l C A 15: 79,081,649 Y166* probably null Het
Emilin1 T A 5: 30,917,784 N456K possibly damaging Het
Fam83f C T 15: 80,692,449 R434C probably damaging Het
Fbxw9 A G 8: 85,060,156 D10G possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fsip2 T G 2: 82,990,951 V5676G possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm11596 A G 11: 99,793,238 probably benign Het
Gm6522 T C 3: 106,275,970 noncoding transcript Het
Gm6728 A G 6: 136,487,074 noncoding transcript Het
Gria4 T A 9: 4,464,295 I556F possibly damaging Het
Grp A T 18: 65,879,970 D69V probably damaging Het
Gucy1a1 G T 3: 82,119,162 probably benign Het
Haus5 A T 7: 30,658,555 L376Q probably damaging Het
Ifne A T 4: 88,879,705 Y159N probably damaging Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Inpp5b T C 4: 124,751,495 V192A probably benign Het
Kcnh4 A G 11: 100,749,743 S486P probably damaging Het
Kif5b A G 18: 6,222,912 probably benign Het
Macf1 T A 4: 123,433,303 E4800D probably damaging Het
Mblac2 C T 13: 81,711,976 Q150* probably null Het
Mc1r A T 8: 123,407,516 T3S probably benign Het
Med17 G A 9: 15,265,372 Q70* probably null Het
Myocd A T 11: 65,179,030 probably null Het
Nphp3 T C 9: 104,031,970 L793P probably benign Het
Olfr1020 T A 2: 85,849,716 M88K probably damaging Het
Olfr1240 T G 2: 89,439,659 T207P possibly damaging Het
Olfr1377 A G 11: 50,985,543 T281A probably damaging Het
Olfr1436 T C 19: 12,298,580 D184G probably damaging Het
Olfr165 A T 16: 19,407,301 F238L probably damaging Het
Olfr891 T A 9: 38,179,900 T308S possibly damaging Het
Piezo1 A T 8: 122,486,921 L1745Q probably damaging Het
Prdm10 T A 9: 31,347,080 H600Q probably damaging Het
Psapl1 C A 5: 36,204,867 L268M probably damaging Het
Psg23 T C 7: 18,612,114 I219V probably benign Het
Rexo5 A T 7: 119,801,330 R113* probably null Het
Rgs22 A T 15: 36,100,212 I243N probably damaging Het
Rhbdf1 G A 11: 32,214,517 T183I probably damaging Het
Rhobtb1 T C 10: 69,270,724 M373T probably benign Het
Ros1 G T 10: 52,172,870 A88E probably damaging Het
Sdr16c6 A G 4: 4,058,834 F251L probably benign Het
Skil A G 3: 31,113,413 Y398C probably damaging Het
Slc22a3 A T 17: 12,464,532 M148K probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Sntn A T 14: 13,679,103 K92N probably benign Het
Spry4 A T 18: 38,589,823 S296T probably benign Het
St8sia1 A G 6: 142,829,070 F261S probably damaging Het
Stab2 C T 10: 86,843,500 probably null Het
Stk24 A T 14: 121,293,454 C363* probably null Het
Tank G A 2: 61,578,635 probably benign Het
Tmem67 T C 4: 12,070,262 N387S probably benign Het
Treml1 A T 17: 48,366,857 I304L probably benign Het
Trim13 A G 14: 61,605,517 I328V probably benign Het
Upk2 A G 9: 44,454,085 V62A probably damaging Het
Urb2 A T 8: 124,029,635 K694* probably null Het
Vmn2r17 C A 5: 109,427,119 N97K probably damaging Het
Vmn2r57 A T 7: 41,400,468 V619D probably damaging Het
Vmn2r92 G A 17: 18,167,372 R213Q probably benign Het
Wnt6 G A 1: 74,782,629 C123Y probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Zfp52 C T 17: 21,561,243 S451L probably damaging Het
Other mutations in Ablim3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Ablim3 APN 18 61849406 missense possibly damaging 0.83
IGL00954:Ablim3 APN 18 61839685 splice site probably benign
IGL01012:Ablim3 APN 18 61839701 missense possibly damaging 0.91
IGL01402:Ablim3 APN 18 61871683 missense probably damaging 0.99
IGL01404:Ablim3 APN 18 61871683 missense probably damaging 0.99
IGL01609:Ablim3 APN 18 61822021 missense probably benign 0.05
IGL01710:Ablim3 APN 18 61871574 missense probably damaging 1.00
IGL01775:Ablim3 APN 18 61816918 splice site probably benign
IGL02967:Ablim3 APN 18 61826503 nonsense probably null
IGL03409:Ablim3 APN 18 61845851 missense probably damaging 1.00
R0143:Ablim3 UTSW 18 61855217 missense probably benign 0.20
R0601:Ablim3 UTSW 18 61849370 missense probably benign 0.19
R1067:Ablim3 UTSW 18 61823947 splice site probably benign
R1642:Ablim3 UTSW 18 61814311 missense probably benign 0.26
R1851:Ablim3 UTSW 18 61849395 missense probably benign 0.33
R1852:Ablim3 UTSW 18 61849395 missense probably benign 0.33
R2072:Ablim3 UTSW 18 61857088 missense possibly damaging 0.74
R2763:Ablim3 UTSW 18 61813544 nonsense probably null
R5190:Ablim3 UTSW 18 61819911 missense probably benign 0.00
R5353:Ablim3 UTSW 18 61801399 missense probably damaging 1.00
R5442:Ablim3 UTSW 18 61857225 intron probably null
R5835:Ablim3 UTSW 18 61823922 missense probably damaging 1.00
R6547:Ablim3 UTSW 18 61823929 missense probably benign 0.01
R7231:Ablim3 UTSW 18 61805064 critical splice donor site probably null
R7386:Ablim3 UTSW 18 61821994 missense probably damaging 1.00
R7404:Ablim3 UTSW 18 61822028 missense probably damaging 0.99
R7529:Ablim3 UTSW 18 61821968 missense probably benign
X0028:Ablim3 UTSW 18 61805112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGACACAGAAGGTCTTCCTAAG -3'
(R):5'- TAACAGTGCACTCTGGGGAC -3'

Sequencing Primer
(F):5'- ATGTTCAATGTGTGCCCCGAAAC -3'
(R):5'- AGCCCTTCCTCCTGACTAAATATCTG -3'
Posted On2016-03-17