Incidental Mutation 'R0281:Ppip5k2'
ID 37488
Institutional Source Beutler Lab
Gene Symbol Ppip5k2
Ensembl Gene ENSMUSG00000040648
Gene Name diphosphoinositol pentakisphosphate kinase 2
Synonyms Hisppd1, Cfap160, Vip2
MMRRC Submission 038503-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.231) question?
Stock # R0281 (G1)
Quality Score 188
Status Validated
Chromosome 1
Chromosomal Location 97633773-97698136 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97644278 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1113 (H1113R)
Ref Sequence ENSEMBL: ENSMUSP00000108466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042509] [ENSMUST00000112845] [ENSMUST00000171129]
AlphaFold Q6ZQB6
Predicted Effect probably benign
Transcript: ENSMUST00000042509
SMART Domains Protein: ENSMUSP00000043401
Gene: ENSMUSG00000040648

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
PDB:4NZO|A 42 366 N/A PDB
Pfam:His_Phos_2 379 894 2.9e-112 PFAM
low complexity region 1073 1092 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112845
AA Change: H1113R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108466
Gene: ENSMUSG00000040648
AA Change: H1113R

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
PDB:4NZO|A 42 366 N/A PDB
Pfam:His_Phos_2 379 894 6.9e-141 PFAM
low complexity region 993 1006 N/A INTRINSIC
low complexity region 1192 1211 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137758
Predicted Effect probably benign
Transcript: ENSMUST00000171129
SMART Domains Protein: ENSMUSP00000132889
Gene: ENSMUSG00000040648

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
PDB:4NZO|A 42 366 N/A PDB
Pfam:His_Phos_2 379 894 2.9e-112 PFAM
low complexity region 1073 1092 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189992
Predicted Effect probably benign
Transcript: ENSMUST00000191556
Meta Mutation Damage Score 0.1335 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the histidine acid phosphatase family of proteins. Despite containing a histidine acid phosphatase domain, the encoded protein functions as an inositol pyrophosphate kinase, and is thought to lack phosphatase activity. This kinase activity is the mechanism by which the encoded protein synthesizes high-energy inositol pyrophosphates, which act as signaling molecules that regulate cellular homeostasis and other processes. This gene may be associated with autism spectrum disorder in human patients. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A T 4: 62,464,304 (GRCm39) R374* probably null Het
5930422O12Rik A T 8: 33,919,407 (GRCm39) R76* probably null Het
A1cf G A 19: 31,923,214 (GRCm39) A505T probably benign Het
Abcc5 T A 16: 20,241,150 (GRCm39) I12F probably damaging Het
Abcf2 T C 5: 24,771,562 (GRCm39) E555G probably damaging Het
Acan A T 7: 78,750,033 (GRCm39) E1601D probably damaging Het
Acsbg3 T A 17: 57,192,169 (GRCm39) Y577* probably null Het
Adam2 T A 14: 66,275,055 (GRCm39) K559N probably benign Het
Akap11 A C 14: 78,747,529 (GRCm39) D1619E possibly damaging Het
Ankrd11 T C 8: 123,622,307 (GRCm39) D515G probably benign Het
Ankrd27 T A 7: 35,318,796 (GRCm39) N562K probably damaging Het
Atp10b T C 11: 43,044,131 (GRCm39) I119T probably benign Het
Atr T C 9: 95,819,619 (GRCm39) I2202T probably benign Het
Bltp2 C T 11: 78,162,750 (GRCm39) L871F possibly damaging Het
Brd4 T A 17: 32,432,514 (GRCm39) probably benign Het
Catsperg2 C T 7: 29,405,996 (GRCm39) C634Y possibly damaging Het
Cep192 A G 18: 67,961,553 (GRCm39) probably benign Het
Cfap65 T A 1: 74,966,230 (GRCm39) I366F probably damaging Het
Cnga4 G T 7: 105,056,875 (GRCm39) R326L probably damaging Het
Cntnap5b T A 1: 99,999,878 (GRCm39) M212K probably benign Het
Col6a6 T A 9: 105,661,315 (GRCm39) M265L probably benign Het
Cspg4b A T 13: 113,505,677 (GRCm39) I727F probably damaging Het
Cyp26b1 A T 6: 84,551,538 (GRCm39) F417Y probably damaging Het
Dhx15 A T 5: 52,308,088 (GRCm39) M768K probably benign Het
Drc7 G A 8: 95,797,881 (GRCm39) R433H possibly damaging Het
Duox2 C T 2: 122,122,785 (GRCm39) V550M probably benign Het
Elmo2 A G 2: 165,138,810 (GRCm39) L456P probably damaging Het
Fbxo39 T C 11: 72,208,356 (GRCm39) I236T probably benign Het
Fezf2 A G 14: 12,343,977 (GRCm38) C305R probably damaging Het
Fndc3b C A 3: 27,511,155 (GRCm39) C785F probably benign Het
Gm12253 T C 11: 58,330,838 (GRCm39) probably benign Het
Gnat2 T A 3: 108,002,878 (GRCm39) Y95* probably null Het
Gopc T C 10: 52,226,774 (GRCm39) K220E probably damaging Het
Hectd4 G A 5: 121,392,314 (GRCm39) D193N possibly damaging Het
Hexa G A 9: 59,461,509 (GRCm39) probably null Het
Hspa4l T C 3: 40,739,840 (GRCm39) probably benign Het
Hspa5 T C 2: 34,664,332 (GRCm39) S301P probably damaging Het
Ice1 A T 13: 70,752,166 (GRCm39) S1307T possibly damaging Het
Igtp T C 11: 58,096,880 (GRCm39) L17P probably damaging Het
Itk T C 11: 46,244,743 (GRCm39) Y225C probably damaging Het
Kifc3 A G 8: 95,830,088 (GRCm39) V560A probably damaging Het
Lama1 A G 17: 68,124,564 (GRCm39) N2875D probably damaging Het
Lasp1 C A 11: 97,697,677 (GRCm39) C32* probably null Het
Lcp2 T A 11: 34,019,854 (GRCm39) probably benign Het
Lhx9 C T 1: 138,760,642 (GRCm39) G236D probably benign Het
Lrrc38 A T 4: 143,076,979 (GRCm39) I81F probably damaging Het
Ly6a C T 15: 74,867,236 (GRCm39) V94M probably benign Het
Map3k13 A G 16: 21,732,907 (GRCm39) E503G probably damaging Het
Mertk T C 2: 128,624,541 (GRCm39) probably benign Het
Mrtfb T A 16: 13,230,027 (GRCm39) I915N probably damaging Het
Msantd2 G A 9: 37,434,515 (GRCm39) D252N possibly damaging Het
Mtmr12 T A 15: 12,257,792 (GRCm39) L290* probably null Het
Myo3a T C 2: 22,250,409 (GRCm39) I92T probably benign Het
Naglu T A 11: 100,964,853 (GRCm39) N313K probably damaging Het
Nceh1 T C 3: 27,276,953 (GRCm39) V92A possibly damaging Het
Ncf4 A G 15: 78,135,083 (GRCm39) T47A probably damaging Het
Nrp1 T A 8: 129,187,164 (GRCm39) F403L probably damaging Het
Nxph3 T C 11: 95,402,082 (GRCm39) T111A possibly damaging Het
Obscn T A 11: 58,929,441 (GRCm39) E6061V probably damaging Het
Obsl1 C A 1: 75,469,571 (GRCm39) G1149W probably damaging Het
Or14c39 A G 7: 86,344,068 (GRCm39) T135A probably benign Het
Or2k2 A T 4: 58,784,981 (GRCm39) V247E probably damaging Het
Or2p2 T A 13: 21,256,544 (GRCm39) Y309F probably benign Het
Or5b123 A G 19: 13,596,849 (GRCm39) T65A probably benign Het
Or5d14 C T 2: 87,880,756 (GRCm39) V71I possibly damaging Het
Or5p68 A C 7: 107,946,121 (GRCm39) D22E probably benign Het
Or6c70 T A 10: 129,710,415 (GRCm39) L70F possibly damaging Het
Pde9a T C 17: 31,674,080 (GRCm39) V55A probably damaging Het
Pip4k2c A T 10: 127,041,690 (GRCm39) probably null Het
Plvap T C 8: 71,964,026 (GRCm39) N112S probably damaging Het
Pop1 T A 15: 34,530,004 (GRCm39) probably null Het
Ptprk A T 10: 28,449,388 (GRCm39) I962F probably damaging Het
Rad51ap2 T C 12: 11,507,043 (GRCm39) S322P possibly damaging Het
Rasal1 A G 5: 120,812,670 (GRCm39) T565A probably benign Het
Rbm15 C A 3: 107,238,471 (GRCm39) R642S probably damaging Het
Rpsa G A 9: 119,960,069 (GRCm39) E211K possibly damaging Het
Ryr3 A G 2: 112,517,155 (GRCm39) S3303P probably damaging Het
Scg2 T A 1: 79,413,229 (GRCm39) N458I possibly damaging Het
Setx A G 2: 29,069,655 (GRCm39) T2487A probably benign Het
Slc4a5 G A 6: 83,244,549 (GRCm39) probably benign Het
Slc8a2 T A 7: 15,874,914 (GRCm39) D387E probably benign Het
Smarcc2 A G 10: 128,310,591 (GRCm39) T407A probably benign Het
Snap25 A G 2: 136,619,384 (GRCm39) D179G probably damaging Het
Socs4 T C 14: 47,527,325 (GRCm39) S74P probably benign Het
Sp6 T A 11: 96,912,751 (GRCm39) Y155N probably benign Het
Srrt C T 5: 137,294,389 (GRCm39) probably benign Het
Steap1 C T 5: 5,786,431 (GRCm39) M335I probably benign Het
Stra6 A T 9: 58,052,772 (GRCm39) Y250F probably benign Het
Svil T C 18: 5,094,582 (GRCm39) S1421P probably damaging Het
Tcea3 G A 4: 135,998,677 (GRCm39) C317Y probably damaging Het
Tmco6 T C 18: 36,870,757 (GRCm39) L117S probably damaging Het
Trp53bp1 T C 2: 121,100,718 (GRCm39) K89E probably damaging Het
Trp63 T A 16: 25,583,052 (GRCm39) probably benign Het
Ube2d2a A G 18: 35,933,185 (GRCm39) Y74C probably damaging Het
Usp19 T G 9: 108,375,708 (GRCm39) F885V probably damaging Het
Utp18 T A 11: 93,773,003 (GRCm39) probably benign Het
Vmn2r116 T C 17: 23,620,387 (GRCm39) I707T possibly damaging Het
Vmn2r68 T A 7: 84,882,457 (GRCm39) probably benign Het
Vmn2r68 C G 7: 84,882,466 (GRCm39) probably null Het
Zfp318 C T 17: 46,723,540 (GRCm39) P1848S probably benign Het
Zfp984 G T 4: 147,839,722 (GRCm39) N376K probably benign Het
Other mutations in Ppip5k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01927:Ppip5k2 APN 1 97,640,848 (GRCm39) missense probably damaging 1.00
IGL02266:Ppip5k2 APN 1 97,661,697 (GRCm39) missense possibly damaging 0.68
IGL02705:Ppip5k2 APN 1 97,686,924 (GRCm39) missense probably damaging 1.00
IGL03229:Ppip5k2 APN 1 97,656,686 (GRCm39) missense probably damaging 1.00
P0033:Ppip5k2 UTSW 1 97,645,253 (GRCm39) missense probably damaging 0.98
R0082:Ppip5k2 UTSW 1 97,687,057 (GRCm39) nonsense probably null
R0242:Ppip5k2 UTSW 1 97,668,816 (GRCm39) missense probably damaging 1.00
R0242:Ppip5k2 UTSW 1 97,668,816 (GRCm39) missense probably damaging 1.00
R0267:Ppip5k2 UTSW 1 97,656,722 (GRCm39) missense probably damaging 1.00
R0373:Ppip5k2 UTSW 1 97,668,262 (GRCm39) nonsense probably null
R0402:Ppip5k2 UTSW 1 97,647,579 (GRCm39) missense probably benign 0.00
R0423:Ppip5k2 UTSW 1 97,689,152 (GRCm39) missense possibly damaging 0.95
R0613:Ppip5k2 UTSW 1 97,680,465 (GRCm39) nonsense probably null
R0751:Ppip5k2 UTSW 1 97,677,377 (GRCm39) nonsense probably null
R1121:Ppip5k2 UTSW 1 97,684,585 (GRCm39) missense probably damaging 1.00
R1265:Ppip5k2 UTSW 1 97,647,625 (GRCm39) missense probably benign 0.00
R1436:Ppip5k2 UTSW 1 97,639,507 (GRCm39) missense probably benign 0.04
R1543:Ppip5k2 UTSW 1 97,668,607 (GRCm39) missense probably damaging 1.00
R1739:Ppip5k2 UTSW 1 97,656,682 (GRCm39) missense probably damaging 1.00
R1845:Ppip5k2 UTSW 1 97,651,531 (GRCm39) missense possibly damaging 0.74
R2191:Ppip5k2 UTSW 1 97,671,835 (GRCm39) missense probably damaging 0.99
R2430:Ppip5k2 UTSW 1 97,662,755 (GRCm39) missense probably damaging 1.00
R2762:Ppip5k2 UTSW 1 97,645,234 (GRCm39) missense probably damaging 1.00
R3014:Ppip5k2 UTSW 1 97,671,800 (GRCm39) missense probably damaging 0.99
R3759:Ppip5k2 UTSW 1 97,683,610 (GRCm39) critical splice donor site probably null
R4603:Ppip5k2 UTSW 1 97,682,861 (GRCm39) missense probably damaging 1.00
R4772:Ppip5k2 UTSW 1 97,648,792 (GRCm39) unclassified probably benign
R4951:Ppip5k2 UTSW 1 97,639,474 (GRCm39) missense possibly damaging 0.77
R5348:Ppip5k2 UTSW 1 97,675,317 (GRCm39) missense possibly damaging 0.94
R5350:Ppip5k2 UTSW 1 97,648,853 (GRCm39) missense probably damaging 0.98
R5584:Ppip5k2 UTSW 1 97,678,366 (GRCm39) missense probably damaging 1.00
R5599:Ppip5k2 UTSW 1 97,668,323 (GRCm39) missense probably damaging 1.00
R5883:Ppip5k2 UTSW 1 97,635,535 (GRCm39) missense possibly damaging 0.53
R5898:Ppip5k2 UTSW 1 97,671,887 (GRCm39) intron probably benign
R6184:Ppip5k2 UTSW 1 97,661,730 (GRCm39) missense possibly damaging 0.89
R6221:Ppip5k2 UTSW 1 97,657,753 (GRCm39) missense probably damaging 1.00
R6775:Ppip5k2 UTSW 1 97,647,585 (GRCm39) missense possibly damaging 0.49
R7250:Ppip5k2 UTSW 1 97,673,187 (GRCm39) missense probably benign 0.00
R7329:Ppip5k2 UTSW 1 97,678,478 (GRCm39) splice site probably null
R7357:Ppip5k2 UTSW 1 97,686,941 (GRCm39) missense possibly damaging 0.91
R7852:Ppip5k2 UTSW 1 97,668,896 (GRCm39) missense probably damaging 0.99
R7884:Ppip5k2 UTSW 1 97,668,207 (GRCm39) missense probably benign 0.00
R8006:Ppip5k2 UTSW 1 97,661,831 (GRCm39) missense probably benign 0.00
R8134:Ppip5k2 UTSW 1 97,672,888 (GRCm39) missense probably benign 0.12
R8274:Ppip5k2 UTSW 1 97,686,941 (GRCm39) missense possibly damaging 0.91
R8436:Ppip5k2 UTSW 1 97,683,613 (GRCm39) missense probably benign
R8440:Ppip5k2 UTSW 1 97,675,276 (GRCm39) missense probably damaging 0.99
R8895:Ppip5k2 UTSW 1 97,639,544 (GRCm39) missense probably benign
R9017:Ppip5k2 UTSW 1 97,655,139 (GRCm39) missense probably damaging 1.00
R9061:Ppip5k2 UTSW 1 97,645,187 (GRCm39) missense probably damaging 1.00
R9441:Ppip5k2 UTSW 1 97,672,921 (GRCm39) missense probably benign 0.00
R9533:Ppip5k2 UTSW 1 97,661,792 (GRCm39) missense probably benign 0.11
R9715:Ppip5k2 UTSW 1 97,677,312 (GRCm39) missense
R9792:Ppip5k2 UTSW 1 97,671,822 (GRCm39) nonsense probably null
R9793:Ppip5k2 UTSW 1 97,671,822 (GRCm39) nonsense probably null
R9795:Ppip5k2 UTSW 1 97,671,822 (GRCm39) nonsense probably null
Z1177:Ppip5k2 UTSW 1 97,644,330 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCCACATCCAGTTGTGTTTCAGCC -3'
(R):5'- TGCCTGTACCATCAAGCCAGTTTAC -3'

Sequencing Primer
(F):5'- ACCTTTAAAAGTCTCAGTGGGGTC -3'
(R):5'- AGCCAGTTTACTGCTTTTAACCAG -3'
Posted On 2013-05-23