Incidental Mutation 'R4866:Uggt1'
ID374881
Institutional Source Beutler Lab
Gene Symbol Uggt1
Ensembl Gene ENSMUSG00000037470
Gene NameUDP-glucose glycoprotein glucosyltransferase 1
SynonymsUgcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik
MMRRC Submission 042476-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R4866 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36140027-36244720 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 36202855 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 333 (R333*)
Ref Sequence ENSEMBL: ENSMUSP00000037930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000174266]
Predicted Effect probably null
Transcript: ENSMUST00000046875
AA Change: R333*
SMART Domains Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470
AA Change: R333*

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:UDP-g_GGTase 44 1222 N/A PFAM
SCOP:d1ga8a_ 1256 1521 3e-45 SMART
Blast:BROMO 1414 1453 3e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172592
Predicted Effect probably benign
Transcript: ENSMUST00000174142
SMART Domains Protein: ENSMUSP00000133929
Gene: ENSMUSG00000037470

DomainStartEndE-ValueType
Pfam:UDP-g_GGTase 1 52 7.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174266
SMART Domains Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174716
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,981,579 probably null Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abcc5 A T 16: 20,422,432 M1K probably null Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adam5 G A 8: 24,781,603 T596I probably damaging Het
Adam5 A C 8: 24,742,156 probably null Het
Apoa2 T C 1: 171,225,800 probably null Het
Arhgap8 A G 15: 84,741,904 Y60C probably damaging Het
Atad1 A T 19: 32,702,564 H79Q probably benign Het
Atp8a2 T C 14: 59,691,467 D1046G probably damaging Het
Bcam A G 7: 19,765,472 Y209H probably benign Het
Brpf1 G A 6: 113,322,470 V1120I probably damaging Het
Catsperb G A 12: 101,507,949 C302Y probably damaging Het
Cbl A G 9: 44,152,869 V790A probably benign Het
Ccdc60 T C 5: 116,172,490 D171G probably damaging Het
Cd300c2 A T 11: 115,000,981 C22* probably null Het
Cdan1 C A 2: 120,731,447 probably benign Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cfap65 T C 1: 74,925,557 D479G probably damaging Het
Cmbl A G 15: 31,585,344 K113E probably benign Het
Cog6 G A 3: 53,010,598 T173I probably benign Het
Cts6 T A 13: 61,202,276 probably null Het
Cyp11a1 G A 9: 58,026,097 V413M probably damaging Het
Cyp2c39 G A 19: 39,513,576 M136I probably benign Het
Dclre1b A T 3: 103,808,096 Y29N probably damaging Het
Depdc1a T A 3: 159,516,127 I236K probably damaging Het
Dhx36 A T 3: 62,472,777 Y833N probably damaging Het
Dopey2 G T 16: 93,763,430 probably null Het
Elovl3 A G 19: 46,132,164 E32G possibly damaging Het
Epcam T C 17: 87,643,621 V212A possibly damaging Het
Fam189a2 A G 19: 23,975,426 S507P possibly damaging Het
Fcrls A T 3: 87,263,466 C4S possibly damaging Het
Galnt16 T C 12: 80,584,077 Y310H probably damaging Het
Gm12789 G A 4: 101,988,985 probably benign Het
Gspt1 C T 16: 11,222,665 R593H possibly damaging Het
Hmcn2 A T 2: 31,389,391 T1802S possibly damaging Het
Igha A G 12: 113,259,509 V166A probably benign Het
Itfg2 A G 6: 128,416,316 probably benign Het
Jund T C 8: 70,699,605 V183A probably damaging Het
Katnb1 T C 8: 95,097,504 S471P possibly damaging Het
Kazn A G 4: 142,104,905 F661S unknown Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Lgr5 C T 10: 115,452,685 V661I probably benign Het
Lvrn G T 18: 46,893,701 A789S probably damaging Het
Mapk10 T C 5: 102,963,525 D351G probably damaging Het
Mga T A 2: 119,964,054 C2622S possibly damaging Het
Mios T G 6: 8,214,857 F18V probably damaging Het
Mllt6 A G 11: 97,674,459 D575G probably damaging Het
Mmp10 G A 9: 7,508,189 V439M probably damaging Het
Myh4 A G 11: 67,248,627 D590G probably benign Het
Ndufs2 C T 1: 171,247,049 G14R probably benign Het
Olfr286 T A 15: 98,227,490 I52F probably damaging Het
Olfr576 A T 7: 102,965,720 M207L probably benign Het
Olfr684 T C 7: 105,157,307 Y125C possibly damaging Het
Olfr943 A G 9: 39,185,071 K298E probably damaging Het
Plau G T 14: 20,837,804 V39L probably benign Het
Ppp3cb A G 14: 20,523,843 C275R probably damaging Het
Ppp4r4 T G 12: 103,600,447 M51R possibly damaging Het
Ptprt T C 2: 161,560,239 D1023G probably damaging Het
Raly T A 2: 154,861,896 V129E probably damaging Het
Rsph10b A G 5: 143,948,529 E249G probably benign Het
Sart1 A C 19: 5,382,220 L577W probably damaging Het
Senp1 T C 15: 98,066,848 E189G possibly damaging Het
Slc22a2 G T 17: 12,584,429 C50F probably damaging Het
Spem1 A T 11: 69,820,929 V303E probably damaging Het
Tgfb3 A G 12: 86,077,814 V40A possibly damaging Het
Ttl T C 2: 129,081,227 S163P probably damaging Het
Ttll9 C A 2: 153,003,000 N429K probably benign Het
Zfhx2 A G 14: 55,065,536 S1664P possibly damaging Het
Zfp51 T A 17: 21,461,750 D70E possibly damaging Het
Zfp592 T A 7: 81,041,859 V1262E probably damaging Het
Zfp595 C A 13: 67,317,696 G168C probably damaging Het
Zswim9 A T 7: 13,261,169 S354T probably damaging Het
Other mutations in Uggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Uggt1 APN 1 36179552 splice site probably benign
IGL00817:Uggt1 APN 1 36185932 missense probably benign 0.03
IGL01395:Uggt1 APN 1 36155077 missense probably damaging 1.00
IGL01609:Uggt1 APN 1 36182474 missense probably damaging 1.00
IGL01619:Uggt1 APN 1 36161694 missense probably damaging 0.99
IGL02077:Uggt1 APN 1 36176794 missense probably damaging 0.99
IGL02313:Uggt1 APN 1 36184484 missense probably damaging 0.99
IGL02341:Uggt1 APN 1 36164519 makesense probably null
IGL02346:Uggt1 APN 1 36179670 missense probably benign 0.00
IGL02447:Uggt1 APN 1 36150142 missense probably damaging 1.00
IGL02883:Uggt1 APN 1 36177615 missense probably benign 0.03
IGL02930:Uggt1 APN 1 36157456 missense probably benign 0.01
IGL03153:Uggt1 APN 1 36202818 missense possibly damaging 0.94
IGL03162:Uggt1 APN 1 36207956 missense probably damaging 1.00
IGL03170:Uggt1 APN 1 36163261 missense probably damaging 1.00
IGL03266:Uggt1 APN 1 36150048 missense probably damaging 1.00
K3955:Uggt1 UTSW 1 36162353 missense probably benign 0.37
R0037:Uggt1 UTSW 1 36185932 missense probably benign 0.03
R0037:Uggt1 UTSW 1 36185932 missense probably benign 0.03
R0167:Uggt1 UTSW 1 36170197 critical splice donor site probably null
R0373:Uggt1 UTSW 1 36179670 missense probably benign 0.00
R0502:Uggt1 UTSW 1 36159946 missense probably damaging 1.00
R0546:Uggt1 UTSW 1 36195971 missense probably benign 0.00
R0610:Uggt1 UTSW 1 36165506 splice site probably benign
R0671:Uggt1 UTSW 1 36155128 missense probably damaging 1.00
R0760:Uggt1 UTSW 1 36161724 missense possibly damaging 0.68
R0825:Uggt1 UTSW 1 36158143 missense probably benign 0.01
R0827:Uggt1 UTSW 1 36156313 critical splice acceptor site probably null
R0884:Uggt1 UTSW 1 36175078 missense probably benign 0.00
R1112:Uggt1 UTSW 1 36173546 missense possibly damaging 0.54
R1470:Uggt1 UTSW 1 36176796 missense probably benign 0.13
R1470:Uggt1 UTSW 1 36176796 missense probably benign 0.13
R1592:Uggt1 UTSW 1 36202858 missense probably benign 0.04
R1730:Uggt1 UTSW 1 36221261 missense probably benign 0.05
R1923:Uggt1 UTSW 1 36179613 missense probably damaging 0.99
R1970:Uggt1 UTSW 1 36151781 missense probably damaging 1.00
R2086:Uggt1 UTSW 1 36192414 missense probably null 1.00
R2829:Uggt1 UTSW 1 36162294 missense probably benign 0.38
R3431:Uggt1 UTSW 1 36210059 nonsense probably null
R3432:Uggt1 UTSW 1 36210059 nonsense probably null
R3725:Uggt1 UTSW 1 36182507 nonsense probably null
R3880:Uggt1 UTSW 1 36176804 intron probably benign
R4052:Uggt1 UTSW 1 36164489 missense probably damaging 0.98
R4133:Uggt1 UTSW 1 36158159 missense probably damaging 1.00
R4489:Uggt1 UTSW 1 36146668 nonsense probably null
R4570:Uggt1 UTSW 1 36150073 missense probably damaging 1.00
R4895:Uggt1 UTSW 1 36156264 missense probably damaging 1.00
R4900:Uggt1 UTSW 1 36202855 nonsense probably null
R5372:Uggt1 UTSW 1 36244060 splice site probably benign
R5385:Uggt1 UTSW 1 36184412 missense probably damaging 1.00
R5652:Uggt1 UTSW 1 36216153 nonsense probably null
R5694:Uggt1 UTSW 1 36179656 missense probably damaging 1.00
R5732:Uggt1 UTSW 1 36161771 splice site probably null
R5893:Uggt1 UTSW 1 36227628 splice site probably null
R6191:Uggt1 UTSW 1 36162208 missense probably damaging 0.98
R6247:Uggt1 UTSW 1 36163228 missense probably damaging 1.00
R6259:Uggt1 UTSW 1 36234916 missense probably benign 0.00
R6399:Uggt1 UTSW 1 36163366 missense possibly damaging 0.90
R6439:Uggt1 UTSW 1 36174951 missense possibly damaging 0.95
R6468:Uggt1 UTSW 1 36173450 missense probably benign 0.00
R6788:Uggt1 UTSW 1 36230688 missense probably benign 0.00
R7165:Uggt1 UTSW 1 36155107 missense probably benign 0.41
R7255:Uggt1 UTSW 1 36146106 missense probably damaging 1.00
R7273:Uggt1 UTSW 1 36162221 missense probably damaging 0.99
R7469:Uggt1 UTSW 1 36151733 missense probably damaging 1.00
R7490:Uggt1 UTSW 1 36164508 missense probably benign 0.01
R7570:Uggt1 UTSW 1 36185838 missense probably benign 0.09
R7612:Uggt1 UTSW 1 36163235 missense probably damaging 0.99
R7759:Uggt1 UTSW 1 36146725 missense possibly damaging 0.81
R7792:Uggt1 UTSW 1 36207984 missense probably damaging 1.00
R7816:Uggt1 UTSW 1 36163315 missense possibly damaging 0.95
R7858:Uggt1 UTSW 1 36156258 missense probably damaging 1.00
R7887:Uggt1 UTSW 1 36208034 missense probably damaging 0.99
R7941:Uggt1 UTSW 1 36156258 missense probably damaging 1.00
R7970:Uggt1 UTSW 1 36208034 missense probably damaging 0.99
R8040:Uggt1 UTSW 1 36211473 missense possibly damaging 0.70
X0022:Uggt1 UTSW 1 36165555 missense possibly damaging 0.67
Z1088:Uggt1 UTSW 1 36174191 missense probably damaging 1.00
Z1176:Uggt1 UTSW 1 36161695 missense probably damaging 1.00
Z1177:Uggt1 UTSW 1 36155073 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTAGAAAGAAGACACTGATCGC -3'
(R):5'- GAACGAGGTCTGAGCTAAGC -3'

Sequencing Primer
(F):5'- GATCGCAACAGTACTTACAAATAGG -3'
(R):5'- TCTGAGCTAAGCCTGGGACAC -3'
Posted On2016-03-17