Mutagenetix > Incidental Mutations

Incidental Mutation 'R4866:Dhx36'

374894

Institutional Source

Beutler Lab

Gene Symbol

Dhx36

Ensembl Gene

ENSMUSG00000027770

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 36

Synonyms

2810407E23Rik, Ddx36

MMRRC Submission

042476-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4866 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62468013-62507004 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62472777 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 833 (Y833N)

Ref Sequence

ENSEMBL: ENSMUSP00000029336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029336]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029336
AA Change: Y833N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029336
Gene: ENSMUSG00000027770
AA Change: Y833N

Domain	Start	End	E-Value	Type
low complexity region	10	45	N/A	INTRINSIC
DEXDc	198	389	1.53e-31	SMART
HELICc	495	600	5.61e-16	SMART
HA2	662	753	2.23e-26	SMART
Pfam:OB_NTP_bind	792	910	1.2e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160858

Meta Mutation Damage Score

0.9625

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.0%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH-box family of RNA-dependent NTPases which are named after the conserved amino acid sequence Asp-Glu-Ala-His in motif II. The protein encoded by this gene has been shown to enhance the deadenylation and decay of mRNAs with 3'-UTR AU-rich elements (ARE-mRNA). The protein has also been shown to resolve into single strands the highly stable tetramolecular DNA configuration (G4) that can form spontaneously in guanine-rich regions of DNA. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality around E7.0. Mice homozygous for a conditional allele activated in the hematopoiesis systemexhibit impaired erythropoiesis associated with cell cycle defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	T	A	10: 77,981,579		probably null	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Abcc5	A	T	16: 20,422,432	M1K	probably null	Het
Ablim2	C	T	5: 35,802,422	R73C	possibly damaging	Het
Adam5	A	C	8: 24,742,156		probably null	Het
Adam5	G	A	8: 24,781,603	T596I	probably damaging	Het
Apoa2	T	C	1: 171,225,800		probably null	Het
Arhgap8	A	G	15: 84,741,904	Y60C	probably damaging	Het
Atad1	A	T	19: 32,702,564	H79Q	probably benign	Het
Atp8a2	T	C	14: 59,691,467	D1046G	probably damaging	Het
Bcam	A	G	7: 19,765,472	Y209H	probably benign	Het
Brpf1	G	A	6: 113,322,470	V1120I	probably damaging	Het
Catsperb	G	A	12: 101,507,949	C302Y	probably damaging	Het
Cbl	A	G	9: 44,152,869	V790A	probably benign	Het
Ccdc60	T	C	5: 116,172,490	D171G	probably damaging	Het
Cd300c2	A	T	11: 115,000,981	C22*	probably null	Het
Cdan1	C	A	2: 120,731,447		probably benign	Het
Cdk5rap1	C	T	2: 154,370,956		probably null	Het
Cfap65	T	C	1: 74,925,557	D479G	probably damaging	Het
Cmbl	A	G	15: 31,585,344	K113E	probably benign	Het
Cog6	G	A	3: 53,010,598	T173I	probably benign	Het
Cts6	T	A	13: 61,202,276		probably null	Het
Cyp11a1	G	A	9: 58,026,097	V413M	probably damaging	Het
Cyp2c39	G	A	19: 39,513,576	M136I	probably benign	Het
Dclre1b	A	T	3: 103,808,096	Y29N	probably damaging	Het
Depdc1a	T	A	3: 159,516,127	I236K	probably damaging	Het
Dopey2	G	T	16: 93,763,430		probably null	Het
Elovl3	A	G	19: 46,132,164	E32G	possibly damaging	Het
Epcam	T	C	17: 87,643,621	V212A	possibly damaging	Het
Fam189a2	A	G	19: 23,975,426	S507P	possibly damaging	Het
Fcrls	A	T	3: 87,263,466	C4S	possibly damaging	Het
Galnt16	T	C	12: 80,584,077	Y310H	probably damaging	Het
Gm12789	G	A	4: 101,988,985		probably benign	Het
Gspt1	C	T	16: 11,222,665	R593H	possibly damaging	Het
Hmcn2	A	T	2: 31,389,391	T1802S	possibly damaging	Het
Igha	A	G	12: 113,259,509	V166A	probably benign	Het
Itfg2	A	G	6: 128,416,316		probably benign	Het
Jund	T	C	8: 70,699,605	V183A	probably damaging	Het
Katnb1	T	C	8: 95,097,504	S471P	possibly damaging	Het
Kazn	A	G	4: 142,104,905	F661S	unknown	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Lgr5	C	T	10: 115,452,685	V661I	probably benign	Het
Lvrn	G	T	18: 46,893,701	A789S	probably damaging	Het
Mapk10	T	C	5: 102,963,525	D351G	probably damaging	Het
Mga	T	A	2: 119,964,054	C2622S	possibly damaging	Het
Mios	T	G	6: 8,214,857	F18V	probably damaging	Het
Mllt6	A	G	11: 97,674,459	D575G	probably damaging	Het
Mmp10	G	A	9: 7,508,189	V439M	probably damaging	Het
Myh4	A	G	11: 67,248,627	D590G	probably benign	Het
Ndufs2	C	T	1: 171,247,049	G14R	probably benign	Het
Olfr286	T	A	15: 98,227,490	I52F	probably damaging	Het
Olfr576	A	T	7: 102,965,720	M207L	probably benign	Het
Olfr684	T	C	7: 105,157,307	Y125C	possibly damaging	Het
Olfr943	A	G	9: 39,185,071	K298E	probably damaging	Het
Plau	G	T	14: 20,837,804	V39L	probably benign	Het
Ppp3cb	A	G	14: 20,523,843	C275R	probably damaging	Het
Ppp4r4	T	G	12: 103,600,447	M51R	possibly damaging	Het
Ptprt	T	C	2: 161,560,239	D1023G	probably damaging	Het
Raly	T	A	2: 154,861,896	V129E	probably damaging	Het
Rsph10b	A	G	5: 143,948,529	E249G	probably benign	Het
Sart1	A	C	19: 5,382,220	L577W	probably damaging	Het
Senp1	T	C	15: 98,066,848	E189G	possibly damaging	Het
Slc22a2	G	T	17: 12,584,429	C50F	probably damaging	Het
Spem1	A	T	11: 69,820,929	V303E	probably damaging	Het
Tgfb3	A	G	12: 86,077,814	V40A	possibly damaging	Het
Ttl	T	C	2: 129,081,227	S163P	probably damaging	Het
Ttll9	C	A	2: 153,003,000	N429K	probably benign	Het
Uggt1	G	A	1: 36,202,855	R333*	probably null	Het
Zfhx2	A	G	14: 55,065,536	S1664P	possibly damaging	Het
Zfp51	T	A	17: 21,461,750	D70E	possibly damaging	Het
Zfp592	T	A	7: 81,041,859	V1262E	probably damaging	Het
Zfp595	C	A	13: 67,317,696	G168C	probably damaging	Het
Zswim9	A	T	7: 13,261,169	S354T	probably damaging	Het

Other mutations in Dhx36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Dhx36	APN	3	62470558	utr 3 prime	probably benign
IGL00538:Dhx36	APN	3	62501045	missense	probably benign	0.04
IGL00706:Dhx36	APN	3	62496842	missense	probably damaging	1.00
IGL02040:Dhx36	APN	3	62501015	missense	probably benign
IGL02141:Dhx36	APN	3	62493889	missense	probably benign	0.25
IGL02514:Dhx36	APN	3	62500898	missense	possibly damaging	0.63
IGL02540:Dhx36	APN	3	62506888	missense	probably benign	0.07
IGL02629:Dhx36	APN	3	62506734	missense	probably benign	0.01
IGL02858:Dhx36	APN	3	62477376	splice site	probably benign
IGL03305:Dhx36	APN	3	62500836	nonsense	probably null
R0002:Dhx36	UTSW	3	62480839	missense	probably damaging	1.00
R0002:Dhx36	UTSW	3	62480839	missense	probably damaging	1.00
R0021:Dhx36	UTSW	3	62477595	missense	possibly damaging	0.66
R0021:Dhx36	UTSW	3	62477595	missense	possibly damaging	0.66
R0671:Dhx36	UTSW	3	62493741	missense	possibly damaging	0.96
R0735:Dhx36	UTSW	3	62472729	missense	probably benign	0.00
R0782:Dhx36	UTSW	3	62506714	splice site	probably benign
R1725:Dhx36	UTSW	3	62506939	start codon destroyed	probably benign	0.01
R1951:Dhx36	UTSW	3	62484273	missense	probably damaging	0.99
R1959:Dhx36	UTSW	3	62479385	missense	probably benign	0.01
R2257:Dhx36	UTSW	3	62477643	missense	probably damaging	1.00
R2397:Dhx36	UTSW	3	62498097	missense	probably benign	0.00
R2484:Dhx36	UTSW	3	62472815	missense	probably damaging	0.96
R2973:Dhx36	UTSW	3	62495495	missense	probably benign	0.00
R2973:Dhx36	UTSW	3	62495498	missense	possibly damaging	0.56
R3617:Dhx36	UTSW	3	62472007	missense	possibly damaging	0.96
R3617:Dhx36	UTSW	3	62487060	missense	probably benign	0.01
R3725:Dhx36	UTSW	3	62488222	splice site	probably benign
R3898:Dhx36	UTSW	3	62492369	missense	probably damaging	0.98
R4332:Dhx36	UTSW	3	62484991	missense	probably damaging	1.00
R4359:Dhx36	UTSW	3	62475278	missense	probably benign	0.05
R4493:Dhx36	UTSW	3	62488504	intron	probably benign
R4652:Dhx36	UTSW	3	62500998	missense	probably benign	0.01
R4884:Dhx36	UTSW	3	62484260	missense	probably damaging	1.00
R4960:Dhx36	UTSW	3	62496859	missense	probably damaging	1.00
R5083:Dhx36	UTSW	3	62471999	missense	probably benign	0.17
R5162:Dhx36	UTSW	3	62493780	missense	probably damaging	1.00
R5815:Dhx36	UTSW	3	62493755	missense	probably damaging	1.00
R6090:Dhx36	UTSW	3	62496820	missense	probably damaging	0.98
R6392:Dhx36	UTSW	3	62494369	missense	probably benign	0.00
R6433:Dhx36	UTSW	3	62484974	missense	probably damaging	1.00
R6504:Dhx36	UTSW	3	62488639	missense	probably benign
R6615:Dhx36	UTSW	3	62488917	missense	probably benign
R6672:Dhx36	UTSW	3	62495536	missense	probably damaging	1.00
R6672:Dhx36	UTSW	3	62500879	missense	probably benign	0.00
R7172:Dhx36	UTSW	3	62501015	missense	probably benign
R7302:Dhx36	UTSW	3	62479393	missense	probably benign
R7487:Dhx36	UTSW	3	62484202	missense	possibly damaging	0.91
R7515:Dhx36	UTSW	3	62472087	missense	probably benign	0.45
R7531:Dhx36	UTSW	3	62484968	missense	probably damaging	1.00
R7579:Dhx36	UTSW	3	62480873	missense	possibly damaging	0.64
R7726:Dhx36	UTSW	3	62488968	missense	probably benign	0.01
R7874:Dhx36	UTSW	3	62488631	missense	probably benign
R7957:Dhx36	UTSW	3	62488631	missense	probably benign
R8056:Dhx36	UTSW	3	62488591	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GACAGATCCCTATGTTCACCG -3'
(R):5'- TGAGCATCTTCTTGGAGCTG -3'

Sequencing Primer
(F):5'- ACAGATCCCTATGTTCACCGATTCC -3'
(R):5'- CTGGATTTGTAAGCAGTAGAAGTCCC -3'

Posted On

2016-03-17