Incidental Mutation 'R0281:Lhx9'
ID 37490
Institutional Source Beutler Lab
Gene Symbol Lhx9
Ensembl Gene ENSMUSG00000019230
Gene Name LIM homeobox protein 9
Synonyms 3110009O07Rik, Lhx9 alpha, LH2B
MMRRC Submission 038503-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.782) question?
Stock # R0281 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 138752924-138776315 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 138760642 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 236 (G236D)
Ref Sequence ENSEMBL: ENSMUSP00000107661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019374] [ENSMUST00000046870] [ENSMUST00000093486] [ENSMUST00000112026] [ENSMUST00000112030] [ENSMUST00000194557]
AlphaFold Q9WUH2
Predicted Effect probably benign
Transcript: ENSMUST00000019374
AA Change: G245D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000019374
Gene: ENSMUSG00000019230
AA Change: G245D

DomainStartEndE-ValueType
LIM 70 123 4.48e-17 SMART
LIM 132 186 8.04e-19 SMART
HOX 267 319 1.89e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046870
AA Change: G236D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000036480
Gene: ENSMUSG00000019230
AA Change: G236D

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 320 8.07e-22 SMART
low complexity region 344 368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093486
AA Change: G236D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000091198
Gene: ENSMUSG00000019230
AA Change: G236D

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 310 1.89e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112026
AA Change: G245D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107657
Gene: ENSMUSG00000019230
AA Change: G245D

DomainStartEndE-ValueType
LIM 70 123 4.48e-17 SMART
LIM 132 186 8.04e-19 SMART
HOX 267 329 8.07e-22 SMART
low complexity region 353 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112030
AA Change: G236D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107661
Gene: ENSMUSG00000019230
AA Change: G236D

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 310 1.89e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192425
Predicted Effect probably benign
Transcript: ENSMUST00000194557
Meta Mutation Damage Score 0.0733 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LIM homeobox gene family of developmentally expressed transcription factors. The encoded protein contains a homeodomain and two cysteine-rich zinc-binding LIM domains involved in protein-protein interactions. The protein is highly similar to a mouse protein that causes gonadal agenesis when inactivated, suggesting a role in gonadal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit failed proliferation of the somatic cells of the genital ridge resulting in lack of discrete gonad formation, infertility in both sexes, and female-like genitalia in genetically male mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A T 4: 62,464,304 (GRCm39) R374* probably null Het
5930422O12Rik A T 8: 33,919,407 (GRCm39) R76* probably null Het
A1cf G A 19: 31,923,214 (GRCm39) A505T probably benign Het
Abcc5 T A 16: 20,241,150 (GRCm39) I12F probably damaging Het
Abcf2 T C 5: 24,771,562 (GRCm39) E555G probably damaging Het
Acan A T 7: 78,750,033 (GRCm39) E1601D probably damaging Het
Acsbg3 T A 17: 57,192,169 (GRCm39) Y577* probably null Het
Adam2 T A 14: 66,275,055 (GRCm39) K559N probably benign Het
Akap11 A C 14: 78,747,529 (GRCm39) D1619E possibly damaging Het
Ankrd11 T C 8: 123,622,307 (GRCm39) D515G probably benign Het
Ankrd27 T A 7: 35,318,796 (GRCm39) N562K probably damaging Het
Atp10b T C 11: 43,044,131 (GRCm39) I119T probably benign Het
Atr T C 9: 95,819,619 (GRCm39) I2202T probably benign Het
Bltp2 C T 11: 78,162,750 (GRCm39) L871F possibly damaging Het
Brd4 T A 17: 32,432,514 (GRCm39) probably benign Het
Catsperg2 C T 7: 29,405,996 (GRCm39) C634Y possibly damaging Het
Cep192 A G 18: 67,961,553 (GRCm39) probably benign Het
Cfap65 T A 1: 74,966,230 (GRCm39) I366F probably damaging Het
Cnga4 G T 7: 105,056,875 (GRCm39) R326L probably damaging Het
Cntnap5b T A 1: 99,999,878 (GRCm39) M212K probably benign Het
Col6a6 T A 9: 105,661,315 (GRCm39) M265L probably benign Het
Cspg4b A T 13: 113,505,677 (GRCm39) I727F probably damaging Het
Cyp26b1 A T 6: 84,551,538 (GRCm39) F417Y probably damaging Het
Dhx15 A T 5: 52,308,088 (GRCm39) M768K probably benign Het
Drc7 G A 8: 95,797,881 (GRCm39) R433H possibly damaging Het
Duox2 C T 2: 122,122,785 (GRCm39) V550M probably benign Het
Elmo2 A G 2: 165,138,810 (GRCm39) L456P probably damaging Het
Fbxo39 T C 11: 72,208,356 (GRCm39) I236T probably benign Het
Fezf2 A G 14: 12,343,977 (GRCm38) C305R probably damaging Het
Fndc3b C A 3: 27,511,155 (GRCm39) C785F probably benign Het
Gm12253 T C 11: 58,330,838 (GRCm39) probably benign Het
Gnat2 T A 3: 108,002,878 (GRCm39) Y95* probably null Het
Gopc T C 10: 52,226,774 (GRCm39) K220E probably damaging Het
Hectd4 G A 5: 121,392,314 (GRCm39) D193N possibly damaging Het
Hexa G A 9: 59,461,509 (GRCm39) probably null Het
Hspa4l T C 3: 40,739,840 (GRCm39) probably benign Het
Hspa5 T C 2: 34,664,332 (GRCm39) S301P probably damaging Het
Ice1 A T 13: 70,752,166 (GRCm39) S1307T possibly damaging Het
Igtp T C 11: 58,096,880 (GRCm39) L17P probably damaging Het
Itk T C 11: 46,244,743 (GRCm39) Y225C probably damaging Het
Kifc3 A G 8: 95,830,088 (GRCm39) V560A probably damaging Het
Lama1 A G 17: 68,124,564 (GRCm39) N2875D probably damaging Het
Lasp1 C A 11: 97,697,677 (GRCm39) C32* probably null Het
Lcp2 T A 11: 34,019,854 (GRCm39) probably benign Het
Lrrc38 A T 4: 143,076,979 (GRCm39) I81F probably damaging Het
Ly6a C T 15: 74,867,236 (GRCm39) V94M probably benign Het
Map3k13 A G 16: 21,732,907 (GRCm39) E503G probably damaging Het
Mertk T C 2: 128,624,541 (GRCm39) probably benign Het
Mrtfb T A 16: 13,230,027 (GRCm39) I915N probably damaging Het
Msantd2 G A 9: 37,434,515 (GRCm39) D252N possibly damaging Het
Mtmr12 T A 15: 12,257,792 (GRCm39) L290* probably null Het
Myo3a T C 2: 22,250,409 (GRCm39) I92T probably benign Het
Naglu T A 11: 100,964,853 (GRCm39) N313K probably damaging Het
Nceh1 T C 3: 27,276,953 (GRCm39) V92A possibly damaging Het
Ncf4 A G 15: 78,135,083 (GRCm39) T47A probably damaging Het
Nrp1 T A 8: 129,187,164 (GRCm39) F403L probably damaging Het
Nxph3 T C 11: 95,402,082 (GRCm39) T111A possibly damaging Het
Obscn T A 11: 58,929,441 (GRCm39) E6061V probably damaging Het
Obsl1 C A 1: 75,469,571 (GRCm39) G1149W probably damaging Het
Or14c39 A G 7: 86,344,068 (GRCm39) T135A probably benign Het
Or2k2 A T 4: 58,784,981 (GRCm39) V247E probably damaging Het
Or2p2 T A 13: 21,256,544 (GRCm39) Y309F probably benign Het
Or5b123 A G 19: 13,596,849 (GRCm39) T65A probably benign Het
Or5d14 C T 2: 87,880,756 (GRCm39) V71I possibly damaging Het
Or5p68 A C 7: 107,946,121 (GRCm39) D22E probably benign Het
Or6c70 T A 10: 129,710,415 (GRCm39) L70F possibly damaging Het
Pde9a T C 17: 31,674,080 (GRCm39) V55A probably damaging Het
Pip4k2c A T 10: 127,041,690 (GRCm39) probably null Het
Plvap T C 8: 71,964,026 (GRCm39) N112S probably damaging Het
Pop1 T A 15: 34,530,004 (GRCm39) probably null Het
Ppip5k2 T C 1: 97,644,278 (GRCm39) H1113R possibly damaging Het
Ptprk A T 10: 28,449,388 (GRCm39) I962F probably damaging Het
Rad51ap2 T C 12: 11,507,043 (GRCm39) S322P possibly damaging Het
Rasal1 A G 5: 120,812,670 (GRCm39) T565A probably benign Het
Rbm15 C A 3: 107,238,471 (GRCm39) R642S probably damaging Het
Rpsa G A 9: 119,960,069 (GRCm39) E211K possibly damaging Het
Ryr3 A G 2: 112,517,155 (GRCm39) S3303P probably damaging Het
Scg2 T A 1: 79,413,229 (GRCm39) N458I possibly damaging Het
Setx A G 2: 29,069,655 (GRCm39) T2487A probably benign Het
Slc4a5 G A 6: 83,244,549 (GRCm39) probably benign Het
Slc8a2 T A 7: 15,874,914 (GRCm39) D387E probably benign Het
Smarcc2 A G 10: 128,310,591 (GRCm39) T407A probably benign Het
Snap25 A G 2: 136,619,384 (GRCm39) D179G probably damaging Het
Socs4 T C 14: 47,527,325 (GRCm39) S74P probably benign Het
Sp6 T A 11: 96,912,751 (GRCm39) Y155N probably benign Het
Srrt C T 5: 137,294,389 (GRCm39) probably benign Het
Steap1 C T 5: 5,786,431 (GRCm39) M335I probably benign Het
Stra6 A T 9: 58,052,772 (GRCm39) Y250F probably benign Het
Svil T C 18: 5,094,582 (GRCm39) S1421P probably damaging Het
Tcea3 G A 4: 135,998,677 (GRCm39) C317Y probably damaging Het
Tmco6 T C 18: 36,870,757 (GRCm39) L117S probably damaging Het
Trp53bp1 T C 2: 121,100,718 (GRCm39) K89E probably damaging Het
Trp63 T A 16: 25,583,052 (GRCm39) probably benign Het
Ube2d2a A G 18: 35,933,185 (GRCm39) Y74C probably damaging Het
Usp19 T G 9: 108,375,708 (GRCm39) F885V probably damaging Het
Utp18 T A 11: 93,773,003 (GRCm39) probably benign Het
Vmn2r116 T C 17: 23,620,387 (GRCm39) I707T possibly damaging Het
Vmn2r68 T A 7: 84,882,457 (GRCm39) probably benign Het
Vmn2r68 C G 7: 84,882,466 (GRCm39) probably null Het
Zfp318 C T 17: 46,723,540 (GRCm39) P1848S probably benign Het
Zfp984 G T 4: 147,839,722 (GRCm39) N376K probably benign Het
Other mutations in Lhx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Lhx9 APN 1 138,756,418 (GRCm39) missense possibly damaging 0.74
IGL01624:Lhx9 APN 1 138,760,521 (GRCm39) nonsense probably null
IGL02149:Lhx9 APN 1 138,759,172 (GRCm39) missense probably damaging 1.00
IGL02452:Lhx9 APN 1 138,769,580 (GRCm39) missense probably damaging 1.00
IGL02982:Lhx9 APN 1 138,766,349 (GRCm39) missense probably damaging 1.00
R0123:Lhx9 UTSW 1 138,766,417 (GRCm39) missense probably damaging 1.00
R0134:Lhx9 UTSW 1 138,766,417 (GRCm39) missense probably damaging 1.00
R0141:Lhx9 UTSW 1 138,767,744 (GRCm39) missense possibly damaging 0.86
R0225:Lhx9 UTSW 1 138,766,417 (GRCm39) missense probably damaging 1.00
R1460:Lhx9 UTSW 1 138,766,447 (GRCm39) splice site probably benign
R1932:Lhx9 UTSW 1 138,769,747 (GRCm39) start gained probably benign
R4738:Lhx9 UTSW 1 138,760,486 (GRCm39) missense probably damaging 1.00
R4792:Lhx9 UTSW 1 138,766,089 (GRCm39) missense possibly damaging 0.87
R4820:Lhx9 UTSW 1 138,766,105 (GRCm39) missense probably benign 0.00
R4877:Lhx9 UTSW 1 138,766,092 (GRCm39) missense probably benign 0.04
R6035:Lhx9 UTSW 1 138,766,281 (GRCm39) missense possibly damaging 0.67
R6035:Lhx9 UTSW 1 138,766,281 (GRCm39) missense possibly damaging 0.67
R6825:Lhx9 UTSW 1 138,769,544 (GRCm39) frame shift probably null
R6852:Lhx9 UTSW 1 138,769,544 (GRCm39) frame shift probably null
R6853:Lhx9 UTSW 1 138,769,544 (GRCm39) frame shift probably null
R7264:Lhx9 UTSW 1 138,760,489 (GRCm39) missense probably damaging 0.98
R8097:Lhx9 UTSW 1 138,766,089 (GRCm39) missense probably damaging 0.97
R8164:Lhx9 UTSW 1 138,760,518 (GRCm39) missense probably damaging 1.00
R8245:Lhx9 UTSW 1 138,766,179 (GRCm39) missense probably benign 0.24
R8278:Lhx9 UTSW 1 138,766,324 (GRCm39) missense probably damaging 0.98
R8951:Lhx9 UTSW 1 138,769,704 (GRCm39) missense probably damaging 1.00
R9761:Lhx9 UTSW 1 138,774,934 (GRCm39) missense probably benign 0.09
Z1177:Lhx9 UTSW 1 138,759,236 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCAATGACGGATGTGGCTTAC -3'
(R):5'- GTGTCCAGGTCTCCCATGTTAGTTG -3'

Sequencing Primer
(F):5'- CGGATGTGGCTTACCTGTAAAAC -3'
(R):5'- GTTGACTGTAGCCACTGTCTTC -3'
Posted On 2013-05-23