Incidental Mutation 'R4866:Kazn'
ID374900
Institutional Source Beutler Lab
Gene Symbol Kazn
Ensembl Gene ENSMUSG00000040606
Gene Namekazrin, periplakin interacting protein
Synonyms
MMRRC Submission 042476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R4866 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location142102390-142239401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142104905 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 661 (F661S)
Gene Model predicted gene model for transcript(s):
Predicted Effect unknown
Transcript: ENSMUST00000155023
AA Change: F661S
SMART Domains Protein: ENSMUSP00000116071
Gene: ENSMUSG00000040606
AA Change: F661S

DomainStartEndE-ValueType
coiled coil region 1 180 N/A INTRINSIC
low complexity region 299 306 N/A INTRINSIC
SAM 367 435 6.32e-6 SMART
SAM 444 512 4.17e-6 SMART
SAM 533 602 3.37e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in desmosome assembly, cell adhesion, cytoskeletal organization, and epidermal differentiation. This protein co-localizes with desmoplakin and the cytolinker protein periplakin. In general, this protein localizes to the nucleus, desmosomes, cell membrane, and cortical actin-based structures. Some isoforms of this protein also associate with microtubules. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity has not been verified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile and grossly normal with no obvious defects in skin development or homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,981,579 probably null Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abcc5 A T 16: 20,422,432 M1K probably null Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adam5 G A 8: 24,781,603 T596I probably damaging Het
Adam5 A C 8: 24,742,156 probably null Het
Apoa2 T C 1: 171,225,800 probably null Het
Arhgap8 A G 15: 84,741,904 Y60C probably damaging Het
Atad1 A T 19: 32,702,564 H79Q probably benign Het
Atp8a2 T C 14: 59,691,467 D1046G probably damaging Het
Bcam A G 7: 19,765,472 Y209H probably benign Het
Brpf1 G A 6: 113,322,470 V1120I probably damaging Het
Catsperb G A 12: 101,507,949 C302Y probably damaging Het
Cbl A G 9: 44,152,869 V790A probably benign Het
Ccdc60 T C 5: 116,172,490 D171G probably damaging Het
Cd300c2 A T 11: 115,000,981 C22* probably null Het
Cdan1 C A 2: 120,731,447 probably benign Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cfap65 T C 1: 74,925,557 D479G probably damaging Het
Cmbl A G 15: 31,585,344 K113E probably benign Het
Cog6 G A 3: 53,010,598 T173I probably benign Het
Cts6 T A 13: 61,202,276 probably null Het
Cyp11a1 G A 9: 58,026,097 V413M probably damaging Het
Cyp2c39 G A 19: 39,513,576 M136I probably benign Het
Dclre1b A T 3: 103,808,096 Y29N probably damaging Het
Depdc1a T A 3: 159,516,127 I236K probably damaging Het
Dhx36 A T 3: 62,472,777 Y833N probably damaging Het
Dopey2 G T 16: 93,763,430 probably null Het
Elovl3 A G 19: 46,132,164 E32G possibly damaging Het
Epcam T C 17: 87,643,621 V212A possibly damaging Het
Fam189a2 A G 19: 23,975,426 S507P possibly damaging Het
Fcrls A T 3: 87,263,466 C4S possibly damaging Het
Galnt16 T C 12: 80,584,077 Y310H probably damaging Het
Gm12789 G A 4: 101,988,985 probably benign Het
Gspt1 C T 16: 11,222,665 R593H possibly damaging Het
Hmcn2 A T 2: 31,389,391 T1802S possibly damaging Het
Igha A G 12: 113,259,509 V166A probably benign Het
Itfg2 A G 6: 128,416,316 probably benign Het
Jund T C 8: 70,699,605 V183A probably damaging Het
Katnb1 T C 8: 95,097,504 S471P possibly damaging Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Lgr5 C T 10: 115,452,685 V661I probably benign Het
Lvrn G T 18: 46,893,701 A789S probably damaging Het
Mapk10 T C 5: 102,963,525 D351G probably damaging Het
Mga T A 2: 119,964,054 C2622S possibly damaging Het
Mios T G 6: 8,214,857 F18V probably damaging Het
Mllt6 A G 11: 97,674,459 D575G probably damaging Het
Mmp10 G A 9: 7,508,189 V439M probably damaging Het
Myh4 A G 11: 67,248,627 D590G probably benign Het
Ndufs2 C T 1: 171,247,049 G14R probably benign Het
Olfr286 T A 15: 98,227,490 I52F probably damaging Het
Olfr576 A T 7: 102,965,720 M207L probably benign Het
Olfr684 T C 7: 105,157,307 Y125C possibly damaging Het
Olfr943 A G 9: 39,185,071 K298E probably damaging Het
Plau G T 14: 20,837,804 V39L probably benign Het
Ppp3cb A G 14: 20,523,843 C275R probably damaging Het
Ppp4r4 T G 12: 103,600,447 M51R possibly damaging Het
Ptprt T C 2: 161,560,239 D1023G probably damaging Het
Raly T A 2: 154,861,896 V129E probably damaging Het
Rsph10b A G 5: 143,948,529 E249G probably benign Het
Sart1 A C 19: 5,382,220 L577W probably damaging Het
Senp1 T C 15: 98,066,848 E189G possibly damaging Het
Slc22a2 G T 17: 12,584,429 C50F probably damaging Het
Spem1 A T 11: 69,820,929 V303E probably damaging Het
Tgfb3 A G 12: 86,077,814 V40A possibly damaging Het
Ttl T C 2: 129,081,227 S163P probably damaging Het
Ttll9 C A 2: 153,003,000 N429K probably benign Het
Uggt1 G A 1: 36,202,855 R333* probably null Het
Zfhx2 A G 14: 55,065,536 S1664P possibly damaging Het
Zfp51 T A 17: 21,461,750 D70E possibly damaging Het
Zfp592 T A 7: 81,041,859 V1262E probably damaging Het
Zfp595 C A 13: 67,317,696 G168C probably damaging Het
Zswim9 A T 7: 13,261,169 S354T probably damaging Het
Other mutations in Kazn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Kazn APN 4 142159043 critical splice donor site probably null
IGL01959:Kazn APN 4 142150884 missense probably damaging 1.00
IGL02237:Kazn APN 4 142147099 missense probably benign 0.31
IGL02351:Kazn APN 4 142147016 critical splice donor site probably null
IGL02358:Kazn APN 4 142147016 critical splice donor site probably null
R1173:Kazn UTSW 4 142159038 splice site probably benign
R2206:Kazn UTSW 4 142118292 splice site probably null
R3406:Kazn UTSW 4 142239195 start gained probably benign
R4007:Kazn UTSW 4 142106892 missense unknown
R4050:Kazn UTSW 4 142106904 missense unknown
R4598:Kazn UTSW 4 142210092 missense possibly damaging 0.53
R4606:Kazn UTSW 4 142118288 splice site probably null
R4631:Kazn UTSW 4 142118160 unclassified probably benign
R5050:Kazn UTSW 4 142118203 unclassified probably benign
R5052:Kazn UTSW 4 142118203 unclassified probably benign
R5054:Kazn UTSW 4 142108646 missense unknown
R5758:Kazn UTSW 4 142141671 critical splice donor site probably null
R6152:Kazn UTSW 4 142109287 missense unknown
R6284:Kazn UTSW 4 142117197 missense probably benign 0.04
R7289:Kazn UTSW 4 142117175 missense
R7414:Kazn UTSW 4 142109338 missense
R7663:Kazn UTSW 4 142104898 missense
R7814:Kazn UTSW 4 142210170 missense unknown
R8031:Kazn UTSW 4 142154551 missense
R8184:Kazn UTSW 4 142118130 missense probably benign 0.04
R8315:Kazn UTSW 4 142141691 missense
Z1177:Kazn UTSW 4 142154504 missense
Predicted Primers PCR Primer
(F):5'- CATGCTGTACAGTGGGGATG -3'
(R):5'- CTTCCATGTGTCTGAGCAGTAGG -3'

Sequencing Primer
(F):5'- ATGGACGGCTCTGGGAC -3'
(R):5'- TGGTACAAATAATGGAGAGCCC -3'
Posted On2016-03-17