Incidental Mutation 'R4866:Adam5'
ID 374915
Institutional Source Beutler Lab
Gene Symbol Adam5
Ensembl Gene ENSMUSG00000031554
Gene Name a disintegrin and metallopeptidase domain 5
Synonyms tMDCII
MMRRC Submission 042476-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R4866 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 25217109-25314385 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 25271619 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 596 (T596I)
Ref Sequence ENSEMBL: ENSMUSP00000147290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050300] [ENSMUST00000118419] [ENSMUST00000209935]
AlphaFold Q3TTE0
Predicted Effect probably damaging
Transcript: ENSMUST00000050300
AA Change: T596I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052661
Gene: ENSMUSG00000031554
AA Change: T596I

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 1.6e-19 PFAM
Pfam:Reprolysin 185 378 7.7e-59 PFAM
DISIN 397 474 9.1e-42 SMART
ACR 475 618 6.9e-58 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 751 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118419
AA Change: T596I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112422
Gene: ENSMUSG00000031554
AA Change: T596I

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 4.7e-30 PFAM
Pfam:Reprolysin 185 378 7.9e-56 PFAM
DISIN 397 474 1.78e-39 SMART
ACR 475 618 2.06e-55 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130939
Predicted Effect unknown
Transcript: ENSMUST00000132180
AA Change: T513I
SMART Domains Protein: ENSMUSP00000121272
Gene: ENSMUSG00000031554
AA Change: T513I

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 1 60 6.7e-14 PFAM
Pfam:Reprolysin 103 296 2.5e-61 PFAM
DISIN 315 392 1.78e-39 SMART
ACR 393 536 2.06e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209935
AA Change: T596I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 C T 17: 24,593,274 (GRCm39) R224C probably damaging Het
Abcc5 A T 16: 20,241,182 (GRCm39) M1K probably null Het
Ablim2 C T 5: 35,959,766 (GRCm39) R73C possibly damaging Het
Apoa2 T C 1: 171,053,369 (GRCm39) probably null Het
Atad1 A T 19: 32,679,964 (GRCm39) H79Q probably benign Het
Atp8a2 T C 14: 59,928,916 (GRCm39) D1046G probably damaging Het
Bcam A G 7: 19,499,397 (GRCm39) Y209H probably benign Het
Brpf1 G A 6: 113,299,431 (GRCm39) V1120I probably damaging Het
Catsperb G A 12: 101,474,208 (GRCm39) C302Y probably damaging Het
Cbl A G 9: 44,064,166 (GRCm39) V790A probably benign Het
Ccdc60 T C 5: 116,310,549 (GRCm39) D171G probably damaging Het
Cd300c2 A T 11: 114,891,807 (GRCm39) C22* probably null Het
Cdan1 C A 2: 120,561,928 (GRCm39) probably benign Het
Cdk5rap1 C T 2: 154,212,876 (GRCm39) probably null Het
Cfap410 T A 10: 77,817,413 (GRCm39) probably null Het
Cfap65 T C 1: 74,964,716 (GRCm39) D479G probably damaging Het
Cmbl A G 15: 31,585,490 (GRCm39) K113E probably benign Het
Cog6 G A 3: 52,918,019 (GRCm39) T173I probably benign Het
Cts6 T A 13: 61,350,090 (GRCm39) probably null Het
Cyp11a1 G A 9: 57,933,380 (GRCm39) V413M probably damaging Het
Cyp2c39 G A 19: 39,502,020 (GRCm39) M136I probably benign Het
Dclre1b A T 3: 103,715,412 (GRCm39) Y29N probably damaging Het
Depdc1a T A 3: 159,221,764 (GRCm39) I236K probably damaging Het
Dhx36 A T 3: 62,380,198 (GRCm39) Y833N probably damaging Het
Dop1b G T 16: 93,560,318 (GRCm39) probably null Het
Elovl3 A G 19: 46,120,603 (GRCm39) E32G possibly damaging Het
Entrep1 A G 19: 23,952,790 (GRCm39) S507P possibly damaging Het
Epcam T C 17: 87,951,049 (GRCm39) V212A possibly damaging Het
Fcrl2 A T 3: 87,170,773 (GRCm39) C4S possibly damaging Het
Galnt16 T C 12: 80,630,851 (GRCm39) Y310H probably damaging Het
Gm12789 G A 4: 101,846,182 (GRCm39) probably benign Het
Gspt1 C T 16: 11,040,529 (GRCm39) R593H possibly damaging Het
Hmcn2 A T 2: 31,279,403 (GRCm39) T1802S possibly damaging Het
Igha A G 12: 113,223,129 (GRCm39) V166A probably benign Het
Itfg2 A G 6: 128,393,279 (GRCm39) probably benign Het
Jund T C 8: 71,152,254 (GRCm39) V183A probably damaging Het
Katnb1 T C 8: 95,824,132 (GRCm39) S471P possibly damaging Het
Kazn A G 4: 141,832,216 (GRCm39) F661S unknown Het
Kif19a G A 11: 114,658,053 (GRCm39) M37I probably benign Het
Lgr5 C T 10: 115,288,590 (GRCm39) V661I probably benign Het
Lvrn G T 18: 47,026,768 (GRCm39) A789S probably damaging Het
Mapk10 T C 5: 103,111,391 (GRCm39) D351G probably damaging Het
Mga T A 2: 119,794,535 (GRCm39) C2622S possibly damaging Het
Mios T G 6: 8,214,857 (GRCm39) F18V probably damaging Het
Mllt6 A G 11: 97,565,285 (GRCm39) D575G probably damaging Het
Mmp10 G A 9: 7,508,190 (GRCm39) V439M probably damaging Het
Myh4 A G 11: 67,139,453 (GRCm39) D590G probably benign Het
Ndufs2 C T 1: 171,074,618 (GRCm39) G14R probably benign Het
Or10ad1b T A 15: 98,125,371 (GRCm39) I52F probably damaging Het
Or51a7 A T 7: 102,614,927 (GRCm39) M207L probably benign Het
Or56a4 T C 7: 104,806,514 (GRCm39) Y125C possibly damaging Het
Or8g26 A G 9: 39,096,367 (GRCm39) K298E probably damaging Het
Plau G T 14: 20,887,872 (GRCm39) V39L probably benign Het
Ppp3cb A G 14: 20,573,911 (GRCm39) C275R probably damaging Het
Ppp4r4 T G 12: 103,566,706 (GRCm39) M51R possibly damaging Het
Prr5 A G 15: 84,626,105 (GRCm39) Y60C probably damaging Het
Ptprt T C 2: 161,402,159 (GRCm39) D1023G probably damaging Het
Raly T A 2: 154,703,816 (GRCm39) V129E probably damaging Het
Rsph10b A G 5: 143,885,347 (GRCm39) E249G probably benign Het
Sart1 A C 19: 5,432,248 (GRCm39) L577W probably damaging Het
Senp1 T C 15: 97,964,729 (GRCm39) E189G possibly damaging Het
Slc22a2 G T 17: 12,803,316 (GRCm39) C50F probably damaging Het
Spem1 A T 11: 69,711,755 (GRCm39) V303E probably damaging Het
Tgfb3 A G 12: 86,124,588 (GRCm39) V40A possibly damaging Het
Ttl T C 2: 128,923,147 (GRCm39) S163P probably damaging Het
Ttll9 C A 2: 152,844,920 (GRCm39) N429K probably benign Het
Uggt1 G A 1: 36,241,936 (GRCm39) R333* probably null Het
Zfhx2 A G 14: 55,302,993 (GRCm39) S1664P possibly damaging Het
Zfp51 T A 17: 21,682,012 (GRCm39) D70E possibly damaging Het
Zfp592 T A 7: 80,691,607 (GRCm39) V1262E probably damaging Het
Zfp595 C A 13: 67,465,760 (GRCm39) G168C probably damaging Het
Zswim9 A T 7: 12,995,095 (GRCm39) S354T probably damaging Het
Other mutations in Adam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Adam5 APN 8 25,308,758 (GRCm39) missense probably benign 0.18
IGL01285:Adam5 APN 8 25,271,610 (GRCm39) missense probably benign 0.02
IGL01310:Adam5 APN 8 25,232,150 (GRCm39) intron probably benign
IGL01510:Adam5 APN 8 25,294,481 (GRCm39) missense probably damaging 1.00
IGL01570:Adam5 APN 8 25,300,839 (GRCm39) missense probably damaging 1.00
IGL02017:Adam5 APN 8 25,271,775 (GRCm39) missense probably benign 0.38
IGL02191:Adam5 APN 8 25,302,439 (GRCm39) nonsense probably null
IGL02397:Adam5 APN 8 25,234,149 (GRCm39) intron probably benign
IGL02488:Adam5 APN 8 25,282,022 (GRCm39) missense probably damaging 0.98
IGL02490:Adam5 APN 8 25,271,720 (GRCm39) nonsense probably null
IGL02499:Adam5 APN 8 25,271,581 (GRCm39) critical splice donor site probably null
IGL02539:Adam5 APN 8 25,276,229 (GRCm39) nonsense probably null
IGL02590:Adam5 APN 8 25,234,151 (GRCm39) intron probably benign
IGL02677:Adam5 APN 8 25,302,395 (GRCm39) splice site probably benign
IGL02679:Adam5 APN 8 25,296,542 (GRCm39) missense probably damaging 1.00
IGL02982:Adam5 APN 8 25,294,447 (GRCm39) missense probably benign 0.02
IGL03146:Adam5 APN 8 25,294,519 (GRCm39) missense probably damaging 0.98
IGL03162:Adam5 APN 8 25,271,620 (GRCm39) missense probably benign 0.30
IGL03284:Adam5 APN 8 25,276,354 (GRCm39) splice site probably benign
R0081:Adam5 UTSW 8 25,271,703 (GRCm39) missense probably damaging 1.00
R0377:Adam5 UTSW 8 25,237,557 (GRCm39) missense probably benign 0.08
R0398:Adam5 UTSW 8 25,303,448 (GRCm39) missense probably benign 0.17
R0771:Adam5 UTSW 8 25,276,315 (GRCm39) missense probably benign 0.04
R0925:Adam5 UTSW 8 25,302,441 (GRCm39) missense probably benign 0.09
R1547:Adam5 UTSW 8 25,300,729 (GRCm39) missense probably benign 0.10
R1985:Adam5 UTSW 8 25,236,755 (GRCm39) missense probably benign 0.01
R2115:Adam5 UTSW 8 25,234,161 (GRCm39) intron probably benign
R2125:Adam5 UTSW 8 25,305,134 (GRCm39) missense probably damaging 1.00
R2144:Adam5 UTSW 8 25,305,496 (GRCm39) missense probably benign 0.14
R3151:Adam5 UTSW 8 25,271,647 (GRCm39) missense probably damaging 0.99
R3612:Adam5 UTSW 8 25,308,105 (GRCm39) splice site probably benign
R3844:Adam5 UTSW 8 25,303,426 (GRCm39) missense probably benign 0.12
R3873:Adam5 UTSW 8 25,305,125 (GRCm39) missense probably benign 0.02
R4514:Adam5 UTSW 8 25,308,152 (GRCm39) missense probably damaging 1.00
R4843:Adam5 UTSW 8 25,303,552 (GRCm39) missense probably damaging 1.00
R4866:Adam5 UTSW 8 25,232,172 (GRCm39) splice site probably null
R4900:Adam5 UTSW 8 25,271,619 (GRCm39) missense probably damaging 0.98
R4900:Adam5 UTSW 8 25,232,172 (GRCm39) splice site probably null
R4903:Adam5 UTSW 8 25,276,248 (GRCm39) missense probably damaging 1.00
R4936:Adam5 UTSW 8 25,276,287 (GRCm39) missense probably damaging 1.00
R4964:Adam5 UTSW 8 25,276,248 (GRCm39) missense probably damaging 1.00
R5259:Adam5 UTSW 8 25,300,850 (GRCm39) missense possibly damaging 0.90
R5293:Adam5 UTSW 8 25,300,722 (GRCm39) missense possibly damaging 0.46
R5724:Adam5 UTSW 8 25,294,511 (GRCm39) nonsense probably null
R5859:Adam5 UTSW 8 25,303,477 (GRCm39) missense probably benign
R6004:Adam5 UTSW 8 25,271,685 (GRCm39) missense probably benign 0.04
R6175:Adam5 UTSW 8 25,276,167 (GRCm39) missense probably benign 0.00
R6539:Adam5 UTSW 8 25,272,616 (GRCm39) missense possibly damaging 0.85
R6994:Adam5 UTSW 8 25,276,262 (GRCm39) nonsense probably null
R6996:Adam5 UTSW 8 25,296,517 (GRCm39) missense probably damaging 1.00
R7009:Adam5 UTSW 8 25,296,454 (GRCm39) missense probably benign 0.00
R7115:Adam5 UTSW 8 25,271,712 (GRCm39) missense possibly damaging 0.69
R7127:Adam5 UTSW 8 25,300,797 (GRCm39) missense probably damaging 1.00
R7469:Adam5 UTSW 8 25,305,541 (GRCm39) missense probably benign 0.45
R7780:Adam5 UTSW 8 25,294,432 (GRCm39) missense possibly damaging 0.49
R8027:Adam5 UTSW 8 25,272,574 (GRCm39) missense probably damaging 1.00
R8069:Adam5 UTSW 8 25,303,541 (GRCm39) missense probably damaging 1.00
R8138:Adam5 UTSW 8 25,271,778 (GRCm39) missense probably damaging 1.00
R8305:Adam5 UTSW 8 25,300,719 (GRCm39) missense possibly damaging 0.93
R8359:Adam5 UTSW 8 25,296,502 (GRCm39) missense probably damaging 1.00
R8480:Adam5 UTSW 8 25,294,475 (GRCm39) nonsense probably null
R8743:Adam5 UTSW 8 25,276,264 (GRCm39) missense probably damaging 1.00
R9000:Adam5 UTSW 8 25,294,372 (GRCm39) critical splice donor site probably null
R9442:Adam5 UTSW 8 25,296,510 (GRCm39) missense probably damaging 0.96
R9474:Adam5 UTSW 8 25,237,540 (GRCm39) missense possibly damaging 0.95
R9602:Adam5 UTSW 8 25,303,402 (GRCm39) missense probably damaging 0.96
R9748:Adam5 UTSW 8 25,301,068 (GRCm39) missense probably benign 0.23
X0019:Adam5 UTSW 8 25,302,459 (GRCm39) missense probably benign 0.00
X0022:Adam5 UTSW 8 25,303,579 (GRCm39) critical splice acceptor site probably null
X0027:Adam5 UTSW 8 25,308,788 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTTACACTGCAGAGGTG -3'
(R):5'- CTGTGGGAAACTAATCTGTACGTG -3'

Sequencing Primer
(F):5'- CCACTAAAATACTCAGCTCTAGGTG -3'
(R):5'- TCTGTACGTGGCCATTCAAGAAG -3'
Posted On 2016-03-17