Mutagenetix > Incidental Mutation

Incidental Mutation 'R0281:Setx'

37492

Institutional Source

Beutler Lab

Gene Symbol

Setx

Ensembl Gene

ENSMUSG00000043535

Gene Name

senataxin

Synonyms

A930037J23Rik, Als4

MMRRC Submission

038503-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0281 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29124181-29182471 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29179643 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2487 (T2487A)

Ref Sequence

ENSEMBL: ENSMUSP00000051492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061578]

AlphaFold

A2AKX3

Predicted Effect

probably benign
Transcript: ENSMUST00000061578
AA Change: T2487A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: T2487A

Domain	Start	End	E-Value	Type
low complexity region	864	876	N/A	INTRINSIC
low complexity region	1002	1020	N/A	INTRINSIC
low complexity region	1058	1079	N/A	INTRINSIC
low complexity region	1575	1594	N/A	INTRINSIC
Pfam:AAA_11	1909	2194	1.9e-68	PFAM
Pfam:AAA_19	1924	2015	2.9e-11	PFAM
Pfam:AAA_12	2201	2402	1.1e-54	PFAM
low complexity region	2499	2516	N/A	INTRINSIC
low complexity region	2576	2587	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000145422

SMART Domains

Protein: ENSMUSP00000119176
Gene: ENSMUSG00000043535

Domain	Start	End	E-Value	Type
Pfam:AAA_11	1	68	5.8e-26	PFAM
Pfam:AAA_12	75	331	4.5e-54	PFAM

Meta Mutation Damage Score

0.0586

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

98% (104/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
2610507B11Rik	C	T	11: 78,271,924	L871F	possibly damaging	Het
4933430I17Rik	A	T	4: 62,546,067	R374*	probably null	Het
5930422O12Rik	A	T	8: 33,429,379	R76*	probably null	Het
A1cf	G	A	19: 31,945,814	A505T	probably benign	Het
Abcc5	T	A	16: 20,422,400	I12F	probably damaging	Het
Abcf2	T	C	5: 24,566,564	E555G	probably damaging	Het
Acan	A	T	7: 79,100,285	E1601D	probably damaging	Het
Adam2	T	A	14: 66,037,606	K559N	probably benign	Het
Akap11	A	C	14: 78,510,089	D1619E	possibly damaging	Het
Ankrd11	T	C	8: 122,895,568	D515G	probably benign	Het
Ankrd27	T	A	7: 35,619,371	N562K	probably damaging	Het
Atp10b	T	C	11: 43,153,304	I119T	probably benign	Het
Atr	T	C	9: 95,937,566	I2202T	probably benign	Het
BC067074	A	T	13: 113,369,143	I727F	probably damaging	Het
Brd4	T	A	17: 32,213,540		probably benign	Het
Catsperg2	C	T	7: 29,706,571	C634Y	possibly damaging	Het
Cep192	A	G	18: 67,828,482		probably benign	Het
Cfap65	T	A	1: 74,927,071	I366F	probably damaging	Het
Cnga4	G	T	7: 105,407,668	R326L	probably damaging	Het
Cntnap5b	T	A	1: 100,072,153	M212K	probably benign	Het
Col6a6	T	A	9: 105,784,116	M265L	probably benign	Het
Cyp26b1	A	T	6: 84,574,556	F417Y	probably damaging	Het
Dhx15	A	T	5: 52,150,746	M768K	probably benign	Het
Drc7	G	A	8: 95,071,253	R433H	possibly damaging	Het
Duox2	C	T	2: 122,292,304	V550M	probably benign	Het
Elmo2	A	G	2: 165,296,890	L456P	probably damaging	Het
Fbxo39	T	C	11: 72,317,530	I236T	probably benign	Het
Fezf2	A	G	14: 12,343,977	C305R	probably damaging	Het
Fndc3b	C	A	3: 27,457,006	C785F	probably benign	Het
Gm12253	T	C	11: 58,440,012		probably benign	Het
Gnat2	T	A	3: 108,095,562	Y95*	probably null	Het
Gopc	T	C	10: 52,350,678	K220E	probably damaging	Het
Hectd4	G	A	5: 121,254,251	D193N	possibly damaging	Het
Hexa	G	A	9: 59,554,226		probably null	Het
Hspa4l	T	C	3: 40,785,408		probably benign	Het
Hspa5	T	C	2: 34,774,320	S301P	probably damaging	Het
Ice1	A	T	13: 70,604,047	S1307T	possibly damaging	Het
Igtp	T	C	11: 58,206,054	L17P	probably damaging	Het
Itk	T	C	11: 46,353,916	Y225C	probably damaging	Het
Kifc3	A	G	8: 95,103,460	V560A	probably damaging	Het
Lama1	A	G	17: 67,817,569	N2875D	probably damaging	Het
Lasp1	C	A	11: 97,806,851	C32*	probably null	Het
Lcp2	T	A	11: 34,069,854		probably benign	Het
Lhx9	C	T	1: 138,832,904	G236D	probably benign	Het
Lrrc38	A	T	4: 143,350,409	I81F	probably damaging	Het
Ly6a	C	T	15: 74,995,387	V94M	probably benign	Het
Map3k13	A	G	16: 21,914,157	E503G	probably damaging	Het
Mertk	T	C	2: 128,782,621		probably benign	Het
Mkl2	T	A	16: 13,412,163	I915N	probably damaging	Het
Msantd2	G	A	9: 37,523,219	D252N	possibly damaging	Het
Mtmr12	T	A	15: 12,257,706	L290*	probably null	Het
Myo3a	T	C	2: 22,245,598	I92T	probably benign	Het
Naglu	T	A	11: 101,074,027	N313K	probably damaging	Het
Nceh1	T	C	3: 27,222,804	V92A	possibly damaging	Het
Ncf4	A	G	15: 78,250,883	T47A	probably damaging	Het
Nrp1	T	A	8: 128,460,683	F403L	probably damaging	Het
Nxph3	T	C	11: 95,511,256	T111A	possibly damaging	Het
Obscn	T	A	11: 59,038,615	E6061V	probably damaging	Het
Obsl1	C	A	1: 75,492,927	G1149W	probably damaging	Het
Olfr1162	C	T	2: 88,050,412	V71I	possibly damaging	Het
Olfr1370	T	A	13: 21,072,374	Y309F	probably benign	Het
Olfr1487	A	G	19: 13,619,485	T65A	probably benign	Het
Olfr267	A	T	4: 58,784,981	V247E	probably damaging	Het
Olfr292	A	G	7: 86,694,860	T135A	probably benign	Het
Olfr493	A	C	7: 108,346,914	D22E	probably benign	Het
Olfr814	T	A	10: 129,874,546	L70F	possibly damaging	Het
Pde9a	T	C	17: 31,455,106	V55A	probably damaging	Het
Pip4k2c	A	T	10: 127,205,821		probably null	Het
Plvap	T	C	8: 71,511,382	N112S	probably damaging	Het
Pop1	T	A	15: 34,529,858		probably null	Het
Ppip5k2	T	C	1: 97,716,553	H1113R	possibly damaging	Het
Ptprk	A	T	10: 28,573,392	I962F	probably damaging	Het
Rad51ap2	T	C	12: 11,457,042	S322P	possibly damaging	Het
Rasal1	A	G	5: 120,674,605	T565A	probably benign	Het
Rbm15	C	A	3: 107,331,155	R642S	probably damaging	Het
Rpsa	G	A	9: 120,131,003	E211K	possibly damaging	Het
Ryr3	A	G	2: 112,686,810	S3303P	probably damaging	Het
Scg2	T	A	1: 79,435,512	N458I	possibly damaging	Het
Slc4a5	G	A	6: 83,267,567		probably benign	Het
Slc8a2	T	A	7: 16,140,989	D387E	probably benign	Het
Smarcc2	A	G	10: 128,474,722	T407A	probably benign	Het
Snap25	A	G	2: 136,777,464	D179G	probably damaging	Het
Socs4	T	C	14: 47,289,868	S74P	probably benign	Het
Sp6	T	A	11: 97,021,925	Y155N	probably benign	Het
Srrt	C	T	5: 137,296,127		probably benign	Het
Steap1	C	T	5: 5,736,431	M335I	probably benign	Het
Stra6	A	T	9: 58,145,489	Y250F	probably benign	Het
Svil	T	C	18: 5,094,582	S1421P	probably damaging	Het
Tcea3	G	A	4: 136,271,366	C317Y	probably damaging	Het
Tmco6	T	C	18: 36,737,704	L117S	probably damaging	Het
Trp53bp1	T	C	2: 121,270,237	K89E	probably damaging	Het
Trp63	T	A	16: 25,764,302		probably benign	Het
Ube2d2a	A	G	18: 35,800,132	Y74C	probably damaging	Het
Usp19	T	G	9: 108,498,509	F885V	probably damaging	Het
Utp18	T	A	11: 93,882,177		probably benign	Het
Vmn2r116	T	C	17: 23,401,413	I707T	possibly damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Zfp318	C	T	17: 46,412,614	P1848S	probably benign	Het
Zfp984	G	T	4: 147,755,265	N376K	probably benign	Het

Other mutations in Setx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00688:Setx	APN	2	29148445	missense	possibly damaging	0.50
IGL00806:Setx	APN	2	29127026	missense	probably damaging	1.00
IGL01346:Setx	APN	2	29144809	missense	probably damaging	1.00
IGL01623:Setx	APN	2	29163009	missense	possibly damaging	0.70
IGL02351:Setx	APN	2	29146964	missense	probably benign	0.45
IGL02358:Setx	APN	2	29146964	missense	probably benign	0.45
IGL02378:Setx	APN	2	29173726	splice site	probably benign
IGL02388:Setx	APN	2	29173653	missense	probably damaging	1.00
IGL02408:Setx	APN	2	29133930	missense	probably damaging	1.00
IGL02425:Setx	APN	2	29148408	missense	probably benign	0.00
IGL03023:Setx	APN	2	29145902	missense	probably benign	0.02
IGL03351:Setx	APN	2	29161799	missense	probably benign	0.25
Addison	UTSW	2	29158905	missense	probably damaging	1.00
dallas	UTSW	2	29154061	frame shift	probably null
Denton	UTSW	2	29145060	missense	possibly damaging	0.81
doggie	UTSW	2	29164550	missense	probably damaging	1.00
Irving	UTSW	2	29139221	missense	probably damaging	0.99
G1Funyon:Setx	UTSW	2	29145690	missense	possibly damaging	0.69
IGL03014:Setx	UTSW	2	29139411	missense	probably damaging	1.00
PIT4403001:Setx	UTSW	2	29133955	missense	probably damaging	1.00
R0027:Setx	UTSW	2	29139221	missense	probably damaging	0.99
R0031:Setx	UTSW	2	29176929	missense	probably benign	0.02
R0070:Setx	UTSW	2	29161525	missense	probably benign	0.00
R0070:Setx	UTSW	2	29161525	missense	probably benign	0.00
R0092:Setx	UTSW	2	29146293	missense	probably benign	0.00
R0193:Setx	UTSW	2	29179673	missense	probably benign	0.21
R0401:Setx	UTSW	2	29166289	nonsense	probably null
R0413:Setx	UTSW	2	29139278	missense	probably damaging	1.00
R0517:Setx	UTSW	2	29157133	missense	probably benign	0.00
R0536:Setx	UTSW	2	29158248	missense	possibly damaging	0.46
R0617:Setx	UTSW	2	29146807	missense	possibly damaging	0.86
R1183:Setx	UTSW	2	29180092	missense	probably benign
R1331:Setx	UTSW	2	29179686	missense	probably benign
R1465:Setx	UTSW	2	29140389	critical splice donor site	probably null
R1465:Setx	UTSW	2	29140389	critical splice donor site	probably null
R1467:Setx	UTSW	2	29158905	missense	probably damaging	1.00
R1467:Setx	UTSW	2	29158905	missense	probably damaging	1.00
R1482:Setx	UTSW	2	29162992	missense	probably damaging	0.99
R1599:Setx	UTSW	2	29140373	missense	probably benign	0.04
R1663:Setx	UTSW	2	29126905	missense	probably damaging	1.00
R1909:Setx	UTSW	2	29163009	missense	possibly damaging	0.70
R2117:Setx	UTSW	2	29130301	missense	probably benign	0.01
R2207:Setx	UTSW	2	29154061	frame shift	probably null
R2221:Setx	UTSW	2	29154061	frame shift	probably null
R2223:Setx	UTSW	2	29148537	missense	possibly damaging	0.89
R2223:Setx	UTSW	2	29154061	frame shift	probably null
R2273:Setx	UTSW	2	29154061	frame shift	probably null
R2274:Setx	UTSW	2	29154061	frame shift	probably null
R2275:Setx	UTSW	2	29154061	frame shift	probably null
R2309:Setx	UTSW	2	29158904	missense	probably damaging	1.00
R2328:Setx	UTSW	2	29154060	frame shift	probably null
R2328:Setx	UTSW	2	29154061	frame shift	probably null
R2329:Setx	UTSW	2	29154061	frame shift	probably null
R2331:Setx	UTSW	2	29154061	frame shift	probably null
R2332:Setx	UTSW	2	29154061	frame shift	probably null
R2429:Setx	UTSW	2	29179898	missense	probably benign	0.00
R2438:Setx	UTSW	2	29154061	frame shift	probably null
R2439:Setx	UTSW	2	29154061	frame shift	probably null
R2496:Setx	UTSW	2	29144801	missense	probably benign	0.11
R2858:Setx	UTSW	2	29154061	frame shift	probably null
R2859:Setx	UTSW	2	29154061	frame shift	probably null
R2884:Setx	UTSW	2	29148625	missense	probably damaging	0.98
R2885:Setx	UTSW	2	29148625	missense	probably damaging	0.98
R2886:Setx	UTSW	2	29148625	missense	probably damaging	0.98
R2915:Setx	UTSW	2	29172324	missense	probably damaging	0.99
R2921:Setx	UTSW	2	29154060	small deletion	probably benign
R2921:Setx	UTSW	2	29154061	frame shift	probably null
R2923:Setx	UTSW	2	29154061	frame shift	probably null
R3426:Setx	UTSW	2	29154061	frame shift	probably null
R3609:Setx	UTSW	2	29154061	frame shift	probably null
R3610:Setx	UTSW	2	29154061	frame shift	probably null
R3731:Setx	UTSW	2	29154061	frame shift	probably null
R3813:Setx	UTSW	2	29154061	frame shift	probably null
R3835:Setx	UTSW	2	29145060	missense	possibly damaging	0.81
R3871:Setx	UTSW	2	29145741	missense	probably damaging	0.98
R4013:Setx	UTSW	2	29154061	frame shift	probably null
R4014:Setx	UTSW	2	29154061	frame shift	probably null
R4015:Setx	UTSW	2	29154061	frame shift	probably null
R4017:Setx	UTSW	2	29154061	frame shift	probably null
R4246:Setx	UTSW	2	29154061	frame shift	probably null
R4248:Setx	UTSW	2	29154061	frame shift	probably null
R4297:Setx	UTSW	2	29154061	frame shift	probably null
R4298:Setx	UTSW	2	29154061	frame shift	probably null
R4539:Setx	UTSW	2	29179748	missense	probably benign	0.14
R4590:Setx	UTSW	2	29144809	missense	probably damaging	1.00
R4632:Setx	UTSW	2	29148615	missense	probably benign	0.23
R4782:Setx	UTSW	2	29144046	missense	probably damaging	0.99
R4801:Setx	UTSW	2	29146373	missense	probably benign	0.14
R4802:Setx	UTSW	2	29146373	missense	probably benign	0.14
R4975:Setx	UTSW	2	29164550	missense	probably damaging	1.00
R5040:Setx	UTSW	2	29139338	missense	probably damaging	1.00
R5133:Setx	UTSW	2	29180081	missense	probably benign	0.02
R5208:Setx	UTSW	2	29166367	missense	possibly damaging	0.63
R5237:Setx	UTSW	2	29146983	missense	probably benign	0.00
R5248:Setx	UTSW	2	29148418	missense	probably benign	0.26
R5288:Setx	UTSW	2	29134033	critical splice donor site	probably null
R5385:Setx	UTSW	2	29134033	critical splice donor site	probably null
R5387:Setx	UTSW	2	29147594	missense	probably benign	0.00
R5407:Setx	UTSW	2	29145474	missense	probably benign	0.00
R5685:Setx	UTSW	2	29171280	missense	probably damaging	1.00
R6110:Setx	UTSW	2	29140290	missense	probably damaging	1.00
R6136:Setx	UTSW	2	29148027	missense	probably benign	0.01
R6310:Setx	UTSW	2	29176935	missense	possibly damaging	0.57
R6328:Setx	UTSW	2	29174462	intron	probably benign
R6358:Setx	UTSW	2	29171348	missense	possibly damaging	0.79
R6384:Setx	UTSW	2	29173558	missense	probably damaging	1.00
R6400:Setx	UTSW	2	29130274	missense	probably damaging	0.97
R6572:Setx	UTSW	2	29173694	missense	possibly damaging	0.63
R6662:Setx	UTSW	2	29158114	missense	probably damaging	0.97
R6898:Setx	UTSW	2	29148108	missense	probably benign	0.00
R7188:Setx	UTSW	2	29148172	missense	probably benign	0.02
R7332:Setx	UTSW	2	29146626	missense	probably benign	0.00
R7357:Setx	UTSW	2	29130301	missense	probably benign	0.01
R7556:Setx	UTSW	2	29146493	missense	possibly damaging	0.88
R7646:Setx	UTSW	2	29177549	missense	possibly damaging	0.94
R7802:Setx	UTSW	2	29147021	missense	probably benign	0.02
R7810:Setx	UTSW	2	29148651	missense	probably benign	0.43
R7831:Setx	UTSW	2	29157108	missense	probably damaging	1.00
R7831:Setx	UTSW	2	29179854	missense	possibly damaging	0.75
R7843:Setx	UTSW	2	29173569	missense	probably damaging	1.00
R7850:Setx	UTSW	2	29147418	missense	probably damaging	1.00
R7858:Setx	UTSW	2	29161550	missense	probably damaging	1.00
R8121:Setx	UTSW	2	29145034	missense	possibly damaging	0.93
R8284:Setx	UTSW	2	29145336	missense	possibly damaging	0.46
R8301:Setx	UTSW	2	29145690	missense	possibly damaging	0.69
R8752:Setx	UTSW	2	29158980	missense	probably damaging	0.97
R8785:Setx	UTSW	2	29145263	missense	probably damaging	1.00
R8871:Setx	UTSW	2	29148102	missense	probably benign	0.11
R8927:Setx	UTSW	2	29126959	missense	possibly damaging	0.59
R8928:Setx	UTSW	2	29126959	missense	possibly damaging	0.59
R9182:Setx	UTSW	2	29171287	missense	probably damaging	1.00
R9334:Setx	UTSW	2	29154020	nonsense	probably null
R9335:Setx	UTSW	2	29145951	missense	probably benign	0.00
R9491:Setx	UTSW	2	29147823	missense	probably benign	0.03
R9551:Setx	UTSW	2	29130232	missense	possibly damaging	0.80
R9627:Setx	UTSW	2	29144649	missense	probably damaging	1.00
R9688:Setx	UTSW	2	29146316	missense	probably damaging	1.00
R9689:Setx	UTSW	2	29161543	missense	probably damaging	1.00
R9747:Setx	UTSW	2	29174365	nonsense	probably null
R9780:Setx	UTSW	2	29126987	missense	possibly damaging	0.88
X0066:Setx	UTSW	2	29147879	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCAGAAGCGTGGGGCCATTATTAAG -3'
(R):5'- TGGATGGCGGCACAACAAAACC -3'

Sequencing Primer
(F):5'- GGCCATTATTAAGACCAGTGAC -3'
(R):5'- CTAGGTCCTGGAAAACCACAG -3'

Posted On

2013-05-23