Incidental Mutation 'R4866:Mllt6'
ID 374927
Institutional Source Beutler Lab
Gene Symbol Mllt6
Ensembl Gene ENSMUSG00000038437
Gene Name myeloid/lymphoid or mixed-lineage leukemia; translocated to, 6
Synonyms Af17
MMRRC Submission 042476-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4866 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 97554240-97576289 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 97565285 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 575 (D575G)
Ref Sequence ENSEMBL: ENSMUSP00000103212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044730] [ENSMUST00000107586]
AlphaFold B1AR10
Predicted Effect probably damaging
Transcript: ENSMUST00000044730
AA Change: D545G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045445
Gene: ENSMUSG00000038437
AA Change: D545G

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 358 380 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 520 536 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 649 666 N/A INTRINSIC
coiled coil region 703 744 N/A INTRINSIC
low complexity region 746 756 N/A INTRINSIC
low complexity region 773 782 N/A INTRINSIC
low complexity region 802 848 N/A INTRINSIC
low complexity region 860 901 N/A INTRINSIC
coiled coil region 915 942 N/A INTRINSIC
low complexity region 995 1018 N/A INTRINSIC
low complexity region 1026 1037 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107586
AA Change: D575G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103212
Gene: ENSMUSG00000038437
AA Change: D575G

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 336 356 N/A INTRINSIC
low complexity region 388 410 N/A INTRINSIC
low complexity region 428 442 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
low complexity region 532 546 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 609 631 N/A INTRINSIC
low complexity region 679 696 N/A INTRINSIC
coiled coil region 733 774 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
low complexity region 803 812 N/A INTRINSIC
low complexity region 832 878 N/A INTRINSIC
low complexity region 890 931 N/A INTRINSIC
coiled coil region 945 972 N/A INTRINSIC
low complexity region 1025 1048 N/A INTRINSIC
low complexity region 1056 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184494
Meta Mutation Damage Score 0.0773 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (79/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 C T 17: 24,593,274 (GRCm39) R224C probably damaging Het
Abcc5 A T 16: 20,241,182 (GRCm39) M1K probably null Het
Ablim2 C T 5: 35,959,766 (GRCm39) R73C possibly damaging Het
Adam5 A C 8: 25,232,172 (GRCm39) probably null Het
Adam5 G A 8: 25,271,619 (GRCm39) T596I probably damaging Het
Apoa2 T C 1: 171,053,369 (GRCm39) probably null Het
Atad1 A T 19: 32,679,964 (GRCm39) H79Q probably benign Het
Atp8a2 T C 14: 59,928,916 (GRCm39) D1046G probably damaging Het
Bcam A G 7: 19,499,397 (GRCm39) Y209H probably benign Het
Brpf1 G A 6: 113,299,431 (GRCm39) V1120I probably damaging Het
Catsperb G A 12: 101,474,208 (GRCm39) C302Y probably damaging Het
Cbl A G 9: 44,064,166 (GRCm39) V790A probably benign Het
Ccdc60 T C 5: 116,310,549 (GRCm39) D171G probably damaging Het
Cd300c2 A T 11: 114,891,807 (GRCm39) C22* probably null Het
Cdan1 C A 2: 120,561,928 (GRCm39) probably benign Het
Cdk5rap1 C T 2: 154,212,876 (GRCm39) probably null Het
Cfap410 T A 10: 77,817,413 (GRCm39) probably null Het
Cfap65 T C 1: 74,964,716 (GRCm39) D479G probably damaging Het
Cmbl A G 15: 31,585,490 (GRCm39) K113E probably benign Het
Cog6 G A 3: 52,918,019 (GRCm39) T173I probably benign Het
Cts6 T A 13: 61,350,090 (GRCm39) probably null Het
Cyp11a1 G A 9: 57,933,380 (GRCm39) V413M probably damaging Het
Cyp2c39 G A 19: 39,502,020 (GRCm39) M136I probably benign Het
Dclre1b A T 3: 103,715,412 (GRCm39) Y29N probably damaging Het
Depdc1a T A 3: 159,221,764 (GRCm39) I236K probably damaging Het
Dhx36 A T 3: 62,380,198 (GRCm39) Y833N probably damaging Het
Dop1b G T 16: 93,560,318 (GRCm39) probably null Het
Elovl3 A G 19: 46,120,603 (GRCm39) E32G possibly damaging Het
Entrep1 A G 19: 23,952,790 (GRCm39) S507P possibly damaging Het
Epcam T C 17: 87,951,049 (GRCm39) V212A possibly damaging Het
Fcrl2 A T 3: 87,170,773 (GRCm39) C4S possibly damaging Het
Galnt16 T C 12: 80,630,851 (GRCm39) Y310H probably damaging Het
Gm12789 G A 4: 101,846,182 (GRCm39) probably benign Het
Gspt1 C T 16: 11,040,529 (GRCm39) R593H possibly damaging Het
Hmcn2 A T 2: 31,279,403 (GRCm39) T1802S possibly damaging Het
Igha A G 12: 113,223,129 (GRCm39) V166A probably benign Het
Itfg2 A G 6: 128,393,279 (GRCm39) probably benign Het
Jund T C 8: 71,152,254 (GRCm39) V183A probably damaging Het
Katnb1 T C 8: 95,824,132 (GRCm39) S471P possibly damaging Het
Kazn A G 4: 141,832,216 (GRCm39) F661S unknown Het
Kif19a G A 11: 114,658,053 (GRCm39) M37I probably benign Het
Lgr5 C T 10: 115,288,590 (GRCm39) V661I probably benign Het
Lvrn G T 18: 47,026,768 (GRCm39) A789S probably damaging Het
Mapk10 T C 5: 103,111,391 (GRCm39) D351G probably damaging Het
Mga T A 2: 119,794,535 (GRCm39) C2622S possibly damaging Het
Mios T G 6: 8,214,857 (GRCm39) F18V probably damaging Het
Mmp10 G A 9: 7,508,190 (GRCm39) V439M probably damaging Het
Myh4 A G 11: 67,139,453 (GRCm39) D590G probably benign Het
Ndufs2 C T 1: 171,074,618 (GRCm39) G14R probably benign Het
Or10ad1b T A 15: 98,125,371 (GRCm39) I52F probably damaging Het
Or51a7 A T 7: 102,614,927 (GRCm39) M207L probably benign Het
Or56a4 T C 7: 104,806,514 (GRCm39) Y125C possibly damaging Het
Or8g26 A G 9: 39,096,367 (GRCm39) K298E probably damaging Het
Plau G T 14: 20,887,872 (GRCm39) V39L probably benign Het
Ppp3cb A G 14: 20,573,911 (GRCm39) C275R probably damaging Het
Ppp4r4 T G 12: 103,566,706 (GRCm39) M51R possibly damaging Het
Prr5 A G 15: 84,626,105 (GRCm39) Y60C probably damaging Het
Ptprt T C 2: 161,402,159 (GRCm39) D1023G probably damaging Het
Raly T A 2: 154,703,816 (GRCm39) V129E probably damaging Het
Rsph10b A G 5: 143,885,347 (GRCm39) E249G probably benign Het
Sart1 A C 19: 5,432,248 (GRCm39) L577W probably damaging Het
Senp1 T C 15: 97,964,729 (GRCm39) E189G possibly damaging Het
Slc22a2 G T 17: 12,803,316 (GRCm39) C50F probably damaging Het
Spem1 A T 11: 69,711,755 (GRCm39) V303E probably damaging Het
Tgfb3 A G 12: 86,124,588 (GRCm39) V40A possibly damaging Het
Ttl T C 2: 128,923,147 (GRCm39) S163P probably damaging Het
Ttll9 C A 2: 152,844,920 (GRCm39) N429K probably benign Het
Uggt1 G A 1: 36,241,936 (GRCm39) R333* probably null Het
Zfhx2 A G 14: 55,302,993 (GRCm39) S1664P possibly damaging Het
Zfp51 T A 17: 21,682,012 (GRCm39) D70E possibly damaging Het
Zfp592 T A 7: 80,691,607 (GRCm39) V1262E probably damaging Het
Zfp595 C A 13: 67,465,760 (GRCm39) G168C probably damaging Het
Zswim9 A T 7: 12,995,095 (GRCm39) S354T probably damaging Het
Other mutations in Mllt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Mllt6 APN 11 97,567,754 (GRCm39) missense probably damaging 1.00
IGL01808:Mllt6 APN 11 97,563,310 (GRCm39) missense possibly damaging 0.88
IGL01967:Mllt6 APN 11 97,565,603 (GRCm39) missense probably damaging 0.98
IGL02247:Mllt6 APN 11 97,561,158 (GRCm39) missense probably benign 0.01
IGL03161:Mllt6 APN 11 97,557,977 (GRCm39) missense probably benign 0.03
R0284:Mllt6 UTSW 11 97,569,431 (GRCm39) missense probably benign 0.02
R0718:Mllt6 UTSW 11 97,567,185 (GRCm39) splice site probably benign
R0783:Mllt6 UTSW 11 97,556,571 (GRCm39) missense probably damaging 0.99
R0811:Mllt6 UTSW 11 97,569,387 (GRCm39) missense probably damaging 0.97
R0812:Mllt6 UTSW 11 97,569,387 (GRCm39) missense probably damaging 0.97
R0904:Mllt6 UTSW 11 97,555,824 (GRCm39) missense probably damaging 1.00
R0960:Mllt6 UTSW 11 97,555,772 (GRCm39) splice site probably benign
R1445:Mllt6 UTSW 11 97,563,277 (GRCm39) splice site probably benign
R1523:Mllt6 UTSW 11 97,555,849 (GRCm39) missense probably damaging 1.00
R1781:Mllt6 UTSW 11 97,563,395 (GRCm39) missense probably benign
R1952:Mllt6 UTSW 11 97,568,048 (GRCm39) missense probably damaging 0.99
R2258:Mllt6 UTSW 11 97,555,802 (GRCm39) missense probably damaging 1.00
R2259:Mllt6 UTSW 11 97,555,802 (GRCm39) missense probably damaging 1.00
R2927:Mllt6 UTSW 11 97,571,602 (GRCm39) missense probably damaging 0.98
R4938:Mllt6 UTSW 11 97,569,233 (GRCm39) missense probably benign
R5039:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5058:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5064:Mllt6 UTSW 11 97,564,775 (GRCm39) missense probably damaging 1.00
R5076:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5115:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5379:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5509:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5510:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5511:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5603:Mllt6 UTSW 11 97,564,331 (GRCm39) missense probably damaging 1.00
R5816:Mllt6 UTSW 11 97,563,400 (GRCm39) missense probably damaging 0.97
R6030:Mllt6 UTSW 11 97,568,051 (GRCm39) missense probably damaging 0.99
R6030:Mllt6 UTSW 11 97,568,051 (GRCm39) missense probably damaging 0.99
R6051:Mllt6 UTSW 11 97,571,569 (GRCm39) nonsense probably null
R6180:Mllt6 UTSW 11 97,569,362 (GRCm39) missense possibly damaging 0.85
R6277:Mllt6 UTSW 11 97,564,774 (GRCm39) missense probably damaging 1.00
R6667:Mllt6 UTSW 11 97,567,760 (GRCm39) missense probably damaging 1.00
R6754:Mllt6 UTSW 11 97,565,273 (GRCm39) missense probably damaging 1.00
R6791:Mllt6 UTSW 11 97,571,428 (GRCm39) missense probably damaging 0.98
R7049:Mllt6 UTSW 11 97,564,637 (GRCm39) missense probably damaging 1.00
R7194:Mllt6 UTSW 11 97,564,394 (GRCm39) missense probably benign 0.23
R7387:Mllt6 UTSW 11 97,565,426 (GRCm39) missense probably benign 0.04
R7484:Mllt6 UTSW 11 97,563,442 (GRCm39) missense probably benign 0.18
R7685:Mllt6 UTSW 11 97,567,790 (GRCm39) missense probably damaging 0.99
R7853:Mllt6 UTSW 11 97,561,142 (GRCm39) missense probably benign
R7862:Mllt6 UTSW 11 97,556,631 (GRCm39) missense probably benign 0.03
R8004:Mllt6 UTSW 11 97,566,966 (GRCm39) missense possibly damaging 0.91
R8498:Mllt6 UTSW 11 97,567,688 (GRCm39) missense possibly damaging 0.86
R9044:Mllt6 UTSW 11 97,554,485 (GRCm39) missense probably damaging 1.00
R9297:Mllt6 UTSW 11 97,563,314 (GRCm39) missense probably damaging 0.96
R9457:Mllt6 UTSW 11 97,556,586 (GRCm39) missense probably benign 0.12
R9557:Mllt6 UTSW 11 97,564,310 (GRCm39) missense probably benign 0.04
Z1177:Mllt6 UTSW 11 97,567,251 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CCTAAGCATTTCCCAGACTGG -3'
(R):5'- TCGTGCACAGCTGAATACAG -3'

Sequencing Primer
(F):5'- CCAGACTGGGGCAGAGTAGTAG -3'
(R):5'- AGAGGGCTTCTGTCCCCATC -3'
Posted On 2016-03-17