Incidental Mutation 'R4866:Cd300c2'
ID374929
Institutional Source Beutler Lab
Gene Symbol Cd300c2
Ensembl Gene ENSMUSG00000044811
Gene NameCD300C molecule 2
SynonymsClm4, Cd300d, LMIR2, MAIR-II, AF251705, DIgR1, Igsf7
MMRRC Submission 042476-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4866 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location114996721-115001880 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 115000981 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 22 (C22*)
Ref Sequence ENSEMBL: ENSMUSP00000090121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092464] [ENSMUST00000141188]
Predicted Effect probably null
Transcript: ENSMUST00000092464
AA Change: C22*
SMART Domains Protein: ENSMUSP00000090121
Gene: ENSMUSG00000044811
AA Change: C22*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 28 134 1.52e-3 SMART
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000141188
AA Change: C52S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124035
Gene: ENSMUSG00000044811
AA Change: C52S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (79/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased stimulated B cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,981,579 probably null Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abcc5 A T 16: 20,422,432 M1K probably null Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adam5 G A 8: 24,781,603 T596I probably damaging Het
Adam5 A C 8: 24,742,156 probably null Het
Apoa2 T C 1: 171,225,800 probably null Het
Arhgap8 A G 15: 84,741,904 Y60C probably damaging Het
Atad1 A T 19: 32,702,564 H79Q probably benign Het
Atp8a2 T C 14: 59,691,467 D1046G probably damaging Het
Bcam A G 7: 19,765,472 Y209H probably benign Het
Brpf1 G A 6: 113,322,470 V1120I probably damaging Het
Catsperb G A 12: 101,507,949 C302Y probably damaging Het
Cbl A G 9: 44,152,869 V790A probably benign Het
Ccdc60 T C 5: 116,172,490 D171G probably damaging Het
Cdan1 C A 2: 120,731,447 probably benign Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cfap65 T C 1: 74,925,557 D479G probably damaging Het
Cmbl A G 15: 31,585,344 K113E probably benign Het
Cog6 G A 3: 53,010,598 T173I probably benign Het
Cts6 T A 13: 61,202,276 probably null Het
Cyp11a1 G A 9: 58,026,097 V413M probably damaging Het
Cyp2c39 G A 19: 39,513,576 M136I probably benign Het
Dclre1b A T 3: 103,808,096 Y29N probably damaging Het
Depdc1a T A 3: 159,516,127 I236K probably damaging Het
Dhx36 A T 3: 62,472,777 Y833N probably damaging Het
Dopey2 G T 16: 93,763,430 probably null Het
Elovl3 A G 19: 46,132,164 E32G possibly damaging Het
Epcam T C 17: 87,643,621 V212A possibly damaging Het
Fam189a2 A G 19: 23,975,426 S507P possibly damaging Het
Fcrls A T 3: 87,263,466 C4S possibly damaging Het
Galnt16 T C 12: 80,584,077 Y310H probably damaging Het
Gm12789 G A 4: 101,988,985 probably benign Het
Gspt1 C T 16: 11,222,665 R593H possibly damaging Het
Hmcn2 A T 2: 31,389,391 T1802S possibly damaging Het
Igha A G 12: 113,259,509 V166A probably benign Het
Itfg2 A G 6: 128,416,316 probably benign Het
Jund T C 8: 70,699,605 V183A probably damaging Het
Katnb1 T C 8: 95,097,504 S471P possibly damaging Het
Kazn A G 4: 142,104,905 F661S unknown Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Lgr5 C T 10: 115,452,685 V661I probably benign Het
Lvrn G T 18: 46,893,701 A789S probably damaging Het
Mapk10 T C 5: 102,963,525 D351G probably damaging Het
Mga T A 2: 119,964,054 C2622S possibly damaging Het
Mios T G 6: 8,214,857 F18V probably damaging Het
Mllt6 A G 11: 97,674,459 D575G probably damaging Het
Mmp10 G A 9: 7,508,189 V439M probably damaging Het
Myh4 A G 11: 67,248,627 D590G probably benign Het
Ndufs2 C T 1: 171,247,049 G14R probably benign Het
Olfr286 T A 15: 98,227,490 I52F probably damaging Het
Olfr576 A T 7: 102,965,720 M207L probably benign Het
Olfr684 T C 7: 105,157,307 Y125C possibly damaging Het
Olfr943 A G 9: 39,185,071 K298E probably damaging Het
Plau G T 14: 20,837,804 V39L probably benign Het
Ppp3cb A G 14: 20,523,843 C275R probably damaging Het
Ppp4r4 T G 12: 103,600,447 M51R possibly damaging Het
Ptprt T C 2: 161,560,239 D1023G probably damaging Het
Raly T A 2: 154,861,896 V129E probably damaging Het
Rsph10b A G 5: 143,948,529 E249G probably benign Het
Sart1 A C 19: 5,382,220 L577W probably damaging Het
Senp1 T C 15: 98,066,848 E189G possibly damaging Het
Slc22a2 G T 17: 12,584,429 C50F probably damaging Het
Spem1 A T 11: 69,820,929 V303E probably damaging Het
Tgfb3 A G 12: 86,077,814 V40A possibly damaging Het
Ttl T C 2: 129,081,227 S163P probably damaging Het
Ttll9 C A 2: 153,003,000 N429K probably benign Het
Uggt1 G A 1: 36,202,855 R333* probably null Het
Zfhx2 A G 14: 55,065,536 S1664P possibly damaging Het
Zfp51 T A 17: 21,461,750 D70E possibly damaging Het
Zfp592 T A 7: 81,041,859 V1262E probably damaging Het
Zfp595 C A 13: 67,317,696 G168C probably damaging Het
Zswim9 A T 7: 13,261,169 S354T probably damaging Het
Other mutations in Cd300c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cd300c2 APN 11 115001549 utr 5 prime probably benign
IGL02695:Cd300c2 APN 11 115001553 utr 5 prime probably benign
IGL03086:Cd300c2 APN 11 115000823 missense possibly damaging 0.76
R1933:Cd300c2 UTSW 11 115000859 missense probably benign 0.22
R4707:Cd300c2 UTSW 11 114996985 missense probably benign 0.03
R4900:Cd300c2 UTSW 11 115000981 nonsense probably null
R4906:Cd300c2 UTSW 11 114997000 missense possibly damaging 0.85
R4908:Cd300c2 UTSW 11 114996946 missense probably damaging 0.97
R4946:Cd300c2 UTSW 11 114996905 missense probably benign 0.04
R5568:Cd300c2 UTSW 11 115000836 missense probably damaging 1.00
R6870:Cd300c2 UTSW 11 115000677 missense probably damaging 0.99
R7474:Cd300c2 UTSW 11 114998296 missense probably benign 0.00
R7826:Cd300c2 UTSW 11 115000818 missense possibly damaging 0.77
R8210:Cd300c2 UTSW 11 115000808 missense possibly damaging 0.89
R8443:Cd300c2 UTSW 11 115000640 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- ATGGTCCCTGATGGTCACTC -3'
(R):5'- TGTGACAGTCAGTGCCATAATCAC -3'

Sequencing Primer
(F):5'- GATGGTCACTCGGCCATTC -3'
(R):5'- GTCAGTGCCATAATCACATAATCTC -3'
Posted On2016-03-17