Incidental Mutation 'R4866:Zfhx2'
ID374939
Institutional Source Beutler Lab
Gene Symbol Zfhx2
Ensembl Gene ENSMUSG00000040721
Gene Namezinc finger homeobox 2
Synonymszfh-5
MMRRC Submission 042476-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.375) question?
Stock #R4866 (G1)
Quality Score199
Status Validated
Chromosome14
Chromosomal Location55060262-55092324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55065536 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1664 (S1664P)
Ref Sequence ENSEMBL: ENSMUSP00000045156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036328] [ENSMUST00000183822] [ENSMUST00000185121]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036328
AA Change: S1664P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045156
Gene: ENSMUSG00000040721
AA Change: S1664P

DomainStartEndE-ValueType
low complexity region 22 42 N/A INTRINSIC
ZnF_C2H2 230 252 1.43e1 SMART
low complexity region 333 345 N/A INTRINSIC
low complexity region 428 439 N/A INTRINSIC
ZnF_C2H2 446 469 8.94e-3 SMART
ZnF_U1 498 532 6.98e-1 SMART
ZnF_C2H2 501 525 3.21e-4 SMART
ZnF_U1 560 594 1.36e0 SMART
ZnF_C2H2 563 587 3.29e-1 SMART
low complexity region 597 623 N/A INTRINSIC
ZnF_C2H2 752 776 6.4e0 SMART
ZnF_C2H2 815 839 2.02e-1 SMART
ZnF_U1 861 895 1.78e1 SMART
ZnF_C2H2 864 888 5.34e-1 SMART
ZnF_C2H2 974 997 1.51e1 SMART
ZnF_C2H2 1003 1026 1.51e0 SMART
low complexity region 1087 1103 N/A INTRINSIC
low complexity region 1106 1126 N/A INTRINSIC
ZnF_U1 1182 1216 3.42e0 SMART
ZnF_C2H2 1185 1209 8.22e-2 SMART
ZnF_U1 1239 1273 3.73e0 SMART
ZnF_C2H2 1242 1266 6.67e-2 SMART
low complexity region 1277 1304 N/A INTRINSIC
low complexity region 1314 1326 N/A INTRINSIC
low complexity region 1332 1346 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
low complexity region 1379 1400 N/A INTRINSIC
low complexity region 1457 1465 N/A INTRINSIC
ZnF_C2H2 1474 1497 5.34e0 SMART
low complexity region 1522 1531 N/A INTRINSIC
low complexity region 1542 1554 N/A INTRINSIC
low complexity region 1562 1583 N/A INTRINSIC
HOX 1589 1651 1.97e-16 SMART
low complexity region 1656 1665 N/A INTRINSIC
coiled coil region 1693 1723 N/A INTRINSIC
ZnF_C2H2 1761 1783 2.53e-2 SMART
low complexity region 1837 1847 N/A INTRINSIC
HOX 1851 1913 2.34e-18 SMART
low complexity region 1984 1995 N/A INTRINSIC
low complexity region 2001 2051 N/A INTRINSIC
HOX 2058 2120 1.52e-17 SMART
ZnF_U1 2136 2170 1.09e1 SMART
ZnF_C2H2 2139 2163 5.4e1 SMART
low complexity region 2328 2354 N/A INTRINSIC
low complexity region 2385 2426 N/A INTRINSIC
ZnF_U1 2482 2516 8.31e-1 SMART
ZnF_C2H2 2485 2509 9.46e0 SMART
low complexity region 2523 2538 N/A INTRINSIC
low complexity region 2553 2562 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176665
SMART Domains Protein: ENSMUSP00000134955
Gene: ENSMUSG00000040721

DomainStartEndE-ValueType
ZnF_C2H2 13 37 5.34e-1 SMART
ZnF_C2H2 133 156 1.51e1 SMART
ZnF_C2H2 162 185 1.51e0 SMART
low complexity region 246 262 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
ZnF_C2H2 344 368 8.22e-2 SMART
ZnF_C2H2 401 425 6.67e-2 SMART
low complexity region 436 463 N/A INTRINSIC
low complexity region 473 485 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
low complexity region 538 559 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183822
SMART Domains Protein: ENSMUSP00000140371
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
PDB:2JMU|A 5 64 3e-23 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185121
Meta Mutation Damage Score 0.0929 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,981,579 probably null Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abcc5 A T 16: 20,422,432 M1K probably null Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adam5 A C 8: 24,742,156 probably null Het
Adam5 G A 8: 24,781,603 T596I probably damaging Het
Apoa2 T C 1: 171,225,800 probably null Het
Arhgap8 A G 15: 84,741,904 Y60C probably damaging Het
Atad1 A T 19: 32,702,564 H79Q probably benign Het
Atp8a2 T C 14: 59,691,467 D1046G probably damaging Het
Bcam A G 7: 19,765,472 Y209H probably benign Het
Brpf1 G A 6: 113,322,470 V1120I probably damaging Het
Catsperb G A 12: 101,507,949 C302Y probably damaging Het
Cbl A G 9: 44,152,869 V790A probably benign Het
Ccdc60 T C 5: 116,172,490 D171G probably damaging Het
Cd300c2 A T 11: 115,000,981 C22* probably null Het
Cdan1 C A 2: 120,731,447 probably benign Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cfap65 T C 1: 74,925,557 D479G probably damaging Het
Cmbl A G 15: 31,585,344 K113E probably benign Het
Cog6 G A 3: 53,010,598 T173I probably benign Het
Cts6 T A 13: 61,202,276 probably null Het
Cyp11a1 G A 9: 58,026,097 V413M probably damaging Het
Cyp2c39 G A 19: 39,513,576 M136I probably benign Het
Dclre1b A T 3: 103,808,096 Y29N probably damaging Het
Depdc1a T A 3: 159,516,127 I236K probably damaging Het
Dhx36 A T 3: 62,472,777 Y833N probably damaging Het
Dopey2 G T 16: 93,763,430 probably null Het
Elovl3 A G 19: 46,132,164 E32G possibly damaging Het
Epcam T C 17: 87,643,621 V212A possibly damaging Het
Fam189a2 A G 19: 23,975,426 S507P possibly damaging Het
Fcrls A T 3: 87,263,466 C4S possibly damaging Het
Galnt16 T C 12: 80,584,077 Y310H probably damaging Het
Gm12789 G A 4: 101,988,985 probably benign Het
Gspt1 C T 16: 11,222,665 R593H possibly damaging Het
Hmcn2 A T 2: 31,389,391 T1802S possibly damaging Het
Igha A G 12: 113,259,509 V166A probably benign Het
Itfg2 A G 6: 128,416,316 probably benign Het
Jund T C 8: 70,699,605 V183A probably damaging Het
Katnb1 T C 8: 95,097,504 S471P possibly damaging Het
Kazn A G 4: 142,104,905 F661S unknown Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Lgr5 C T 10: 115,452,685 V661I probably benign Het
Lvrn G T 18: 46,893,701 A789S probably damaging Het
Mapk10 T C 5: 102,963,525 D351G probably damaging Het
Mga T A 2: 119,964,054 C2622S possibly damaging Het
Mios T G 6: 8,214,857 F18V probably damaging Het
Mllt6 A G 11: 97,674,459 D575G probably damaging Het
Mmp10 G A 9: 7,508,189 V439M probably damaging Het
Myh4 A G 11: 67,248,627 D590G probably benign Het
Ndufs2 C T 1: 171,247,049 G14R probably benign Het
Olfr286 T A 15: 98,227,490 I52F probably damaging Het
Olfr576 A T 7: 102,965,720 M207L probably benign Het
Olfr684 T C 7: 105,157,307 Y125C possibly damaging Het
Olfr943 A G 9: 39,185,071 K298E probably damaging Het
Plau G T 14: 20,837,804 V39L probably benign Het
Ppp3cb A G 14: 20,523,843 C275R probably damaging Het
Ppp4r4 T G 12: 103,600,447 M51R possibly damaging Het
Ptprt T C 2: 161,560,239 D1023G probably damaging Het
Raly T A 2: 154,861,896 V129E probably damaging Het
Rsph10b A G 5: 143,948,529 E249G probably benign Het
Sart1 A C 19: 5,382,220 L577W probably damaging Het
Senp1 T C 15: 98,066,848 E189G possibly damaging Het
Slc22a2 G T 17: 12,584,429 C50F probably damaging Het
Spem1 A T 11: 69,820,929 V303E probably damaging Het
Tgfb3 A G 12: 86,077,814 V40A possibly damaging Het
Ttl T C 2: 129,081,227 S163P probably damaging Het
Ttll9 C A 2: 153,003,000 N429K probably benign Het
Uggt1 G A 1: 36,202,855 R333* probably null Het
Zfp51 T A 17: 21,461,750 D70E possibly damaging Het
Zfp592 T A 7: 81,041,859 V1262E probably damaging Het
Zfp595 C A 13: 67,317,696 G168C probably damaging Het
Zswim9 A T 7: 13,261,169 S354T probably damaging Het
Other mutations in Zfhx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Zfhx2 APN 14 55066565 missense possibly damaging 0.93
IGL00164:Zfhx2 APN 14 55065026 missense possibly damaging 0.73
IGL00235:Zfhx2 APN 14 55063257 missense probably benign 0.11
IGL00925:Zfhx2 APN 14 55073061 missense probably benign 0.06
IGL01025:Zfhx2 APN 14 55064260 missense probably damaging 1.00
IGL01061:Zfhx2 APN 14 55073882 missense possibly damaging 0.96
IGL01486:Zfhx2 APN 14 55067090 missense probably damaging 1.00
IGL01875:Zfhx2 APN 14 55063915 missense unknown
IGL01990:Zfhx2 APN 14 55073590 missense probably damaging 0.99
IGL02097:Zfhx2 APN 14 55062894 missense probably damaging 1.00
IGL02269:Zfhx2 APN 14 55071936 missense probably benign 0.00
IGL02488:Zfhx2 APN 14 55065103 missense possibly damaging 0.72
IGL02624:Zfhx2 APN 14 55066628 missense probably benign 0.06
IGL03087:Zfhx2 APN 14 55072845 missense possibly damaging 0.85
PIT4403001:Zfhx2 UTSW 14 55074980 missense probably benign
R0148:Zfhx2 UTSW 14 55072897 missense possibly damaging 0.86
R0323:Zfhx2 UTSW 14 55065979 missense possibly damaging 0.73
R0328:Zfhx2 UTSW 14 55071988 missense probably benign
R0348:Zfhx2 UTSW 14 55063508 missense probably damaging 0.99
R0442:Zfhx2 UTSW 14 55066900 missense possibly damaging 0.53
R0533:Zfhx2 UTSW 14 55064090 missense probably benign 0.23
R0561:Zfhx2 UTSW 14 55065889 missense probably benign 0.01
R0627:Zfhx2 UTSW 14 55065327 missense probably benign
R0659:Zfhx2 UTSW 14 55073801 missense possibly damaging 0.73
R0675:Zfhx2 UTSW 14 55063163 missense probably damaging 0.99
R1301:Zfhx2 UTSW 14 55063397 missense probably benign 0.32
R1563:Zfhx2 UTSW 14 55065088 missense probably benign 0.33
R1607:Zfhx2 UTSW 14 55062985 missense probably damaging 1.00
R1694:Zfhx2 UTSW 14 55073944 missense possibly damaging 0.91
R1710:Zfhx2 UTSW 14 55065998 missense possibly damaging 0.70
R1773:Zfhx2 UTSW 14 55072891 missense possibly damaging 0.53
R1879:Zfhx2 UTSW 14 55065617 missense probably benign 0.32
R1879:Zfhx2 UTSW 14 55072749 missense possibly damaging 0.96
R1933:Zfhx2 UTSW 14 55075238 start gained probably benign
R1944:Zfhx2 UTSW 14 55074732 missense probably benign 0.18
R2888:Zfhx2 UTSW 14 55064803 missense possibly damaging 0.71
R2889:Zfhx2 UTSW 14 55064803 missense possibly damaging 0.71
R2915:Zfhx2 UTSW 14 55064557 missense probably damaging 0.98
R3971:Zfhx2 UTSW 14 55074475 missense probably benign 0.33
R4082:Zfhx2 UTSW 14 55065205 missense probably benign
R4134:Zfhx2 UTSW 14 55065143 missense possibly damaging 0.93
R4231:Zfhx2 UTSW 14 55073534 missense possibly damaging 0.73
R4675:Zfhx2 UTSW 14 55067221 missense probably benign 0.03
R4764:Zfhx2 UTSW 14 55066915 missense possibly damaging 0.96
R4940:Zfhx2 UTSW 14 55066434 missense possibly damaging 0.53
R5125:Zfhx2 UTSW 14 55074775 missense probably benign 0.00
R5178:Zfhx2 UTSW 14 55074775 missense probably benign 0.00
R5554:Zfhx2 UTSW 14 55064317 missense probably damaging 1.00
R5689:Zfhx2 UTSW 14 55073903 missense possibly damaging 0.53
R5768:Zfhx2 UTSW 14 55074365 missense probably benign
R5792:Zfhx2 UTSW 14 55066846 missense possibly damaging 0.72
R5834:Zfhx2 UTSW 14 55073330 nonsense probably null
R5895:Zfhx2 UTSW 14 55065891 missense probably benign
R5999:Zfhx2 UTSW 14 55074005 missense probably benign
R6025:Zfhx2 UTSW 14 55065208 missense probably benign 0.00
R6106:Zfhx2 UTSW 14 55068310 critical splice acceptor site probably null
R6135:Zfhx2 UTSW 14 55074196 missense possibly damaging 0.85
R6186:Zfhx2 UTSW 14 55063160 missense probably damaging 0.99
R6379:Zfhx2 UTSW 14 55074338 missense probably benign
R6725:Zfhx2 UTSW 14 55064082 nonsense probably null
R7089:Zfhx2 UTSW 14 55065772 missense probably benign 0.33
R7383:Zfhx2 UTSW 14 55068253 missense probably benign 0.00
R7470:Zfhx2 UTSW 14 55066750 missense possibly damaging 0.52
R7606:Zfhx2 UTSW 14 55066663 missense probably benign 0.12
R7607:Zfhx2 UTSW 14 55066231 missense possibly damaging 0.86
R7698:Zfhx2 UTSW 14 55062849 missense probably benign 0.00
R7730:Zfhx2 UTSW 14 55066900 missense possibly damaging 0.53
R8142:Zfhx2 UTSW 14 55073438 missense possibly damaging 0.86
R8188:Zfhx2 UTSW 14 55064441 missense probably benign 0.18
R8212:Zfhx2 UTSW 14 55072916 missense possibly damaging 0.70
R8264:Zfhx2 UTSW 14 55065512 missense possibly damaging 0.53
R8331:Zfhx2 UTSW 14 55071987 missense probably benign 0.00
R8369:Zfhx2 UTSW 14 55066744 missense probably benign 0.05
R8371:Zfhx2 UTSW 14 55064092 missense probably damaging 0.99
R8383:Zfhx2 UTSW 14 55074071 missense possibly damaging 0.73
R8415:Zfhx2 UTSW 14 55070622 missense probably benign
R8441:Zfhx2 UTSW 14 55066528 missense possibly damaging 0.96
R8504:Zfhx2 UTSW 14 55065786 missense probably benign 0.00
X0065:Zfhx2 UTSW 14 55066960 missense probably benign 0.33
Z1088:Zfhx2 UTSW 14 55074180 missense possibly damaging 0.73
Z1177:Zfhx2 UTSW 14 55065920 missense probably benign 0.40
Z1177:Zfhx2 UTSW 14 55066982 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TTGGCTCCGTTTGGCTCAAG -3'
(R):5'- CTTTGAGACCAGTGCCTACC -3'

Sequencing Primer
(F):5'- CCCATCTGCATGTTCTGGTGATG -3'
(R):5'- AGTGCCTACCCCAAGGACG -3'
Posted On2016-03-17