Mutagenetix > Incidental Mutation

Incidental Mutation 'R0281:Duox2'

37497

Institutional Source

Beutler Lab

Gene Symbol

Duox2

Ensembl Gene

ENSMUSG00000068452

Gene Name

dual oxidase 2

Synonyms

A430065P05Rik

MMRRC Submission

038503-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0281 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122279247-122298165 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 122292304 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 550 (V550M)

Ref Sequence

ENSEMBL: ENSMUSP00000050314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053734]

AlphaFold

A0A494BAW1

Predicted Effect

probably benign
Transcript: ENSMUST00000053734
AA Change: V550M

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000050314
Gene: ENSMUSG00000068452
AA Change: V550M

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:An_peroxidase	35	560	5e-131	PFAM
transmembrane domain	600	622	N/A	INTRINSIC
EFh	823	851	3.7e-5	SMART
EFh	859	887	2.09e-4	SMART
transmembrane domain	1010	1032	N/A	INTRINSIC
Pfam:Ferric_reduct	1053	1202	1.8e-22	PFAM
Pfam:FAD_binding_8	1238	1340	3.1e-20	PFAM
Pfam:NAD_binding_6	1346	1500	1.5e-33	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

98% (104/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes this encoded protein and DUOX1. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation fail to breed and are congenitally hypothyroid (low T4, high TSH), dwarf, and hearing impaired. Anterior pituitaries are dysplastic. Cochlear defects include delayed formation of the inner sulcus and tunnel of Corti and a thickened tectorial membrane. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
2610507B11Rik	C	T	11: 78,271,924	L871F	possibly damaging	Het
4933430I17Rik	A	T	4: 62,546,067	R374*	probably null	Het
5930422O12Rik	A	T	8: 33,429,379	R76*	probably null	Het
A1cf	G	A	19: 31,945,814	A505T	probably benign	Het
Abcc5	T	A	16: 20,422,400	I12F	probably damaging	Het
Abcf2	T	C	5: 24,566,564	E555G	probably damaging	Het
Acan	A	T	7: 79,100,285	E1601D	probably damaging	Het
Adam2	T	A	14: 66,037,606	K559N	probably benign	Het
Akap11	A	C	14: 78,510,089	D1619E	possibly damaging	Het
Ankrd11	T	C	8: 122,895,568	D515G	probably benign	Het
Ankrd27	T	A	7: 35,619,371	N562K	probably damaging	Het
Atp10b	T	C	11: 43,153,304	I119T	probably benign	Het
Atr	T	C	9: 95,937,566	I2202T	probably benign	Het
BC067074	A	T	13: 113,369,143	I727F	probably damaging	Het
Brd4	T	A	17: 32,213,540		probably benign	Het
Catsperg2	C	T	7: 29,706,571	C634Y	possibly damaging	Het
Cep192	A	G	18: 67,828,482		probably benign	Het
Cfap65	T	A	1: 74,927,071	I366F	probably damaging	Het
Cnga4	G	T	7: 105,407,668	R326L	probably damaging	Het
Cntnap5b	T	A	1: 100,072,153	M212K	probably benign	Het
Col6a6	T	A	9: 105,784,116	M265L	probably benign	Het
Cyp26b1	A	T	6: 84,574,556	F417Y	probably damaging	Het
Dhx15	A	T	5: 52,150,746	M768K	probably benign	Het
Drc7	G	A	8: 95,071,253	R433H	possibly damaging	Het
Elmo2	A	G	2: 165,296,890	L456P	probably damaging	Het
Fbxo39	T	C	11: 72,317,530	I236T	probably benign	Het
Fezf2	A	G	14: 12,343,977	C305R	probably damaging	Het
Fndc3b	C	A	3: 27,457,006	C785F	probably benign	Het
Gm12253	T	C	11: 58,440,012		probably benign	Het
Gnat2	T	A	3: 108,095,562	Y95*	probably null	Het
Gopc	T	C	10: 52,350,678	K220E	probably damaging	Het
Hectd4	G	A	5: 121,254,251	D193N	possibly damaging	Het
Hexa	G	A	9: 59,554,226		probably null	Het
Hspa4l	T	C	3: 40,785,408		probably benign	Het
Hspa5	T	C	2: 34,774,320	S301P	probably damaging	Het
Ice1	A	T	13: 70,604,047	S1307T	possibly damaging	Het
Igtp	T	C	11: 58,206,054	L17P	probably damaging	Het
Itk	T	C	11: 46,353,916	Y225C	probably damaging	Het
Kifc3	A	G	8: 95,103,460	V560A	probably damaging	Het
Lama1	A	G	17: 67,817,569	N2875D	probably damaging	Het
Lasp1	C	A	11: 97,806,851	C32*	probably null	Het
Lcp2	T	A	11: 34,069,854		probably benign	Het
Lhx9	C	T	1: 138,832,904	G236D	probably benign	Het
Lrrc38	A	T	4: 143,350,409	I81F	probably damaging	Het
Ly6a	C	T	15: 74,995,387	V94M	probably benign	Het
Map3k13	A	G	16: 21,914,157	E503G	probably damaging	Het
Mertk	T	C	2: 128,782,621		probably benign	Het
Mkl2	T	A	16: 13,412,163	I915N	probably damaging	Het
Msantd2	G	A	9: 37,523,219	D252N	possibly damaging	Het
Mtmr12	T	A	15: 12,257,706	L290*	probably null	Het
Myo3a	T	C	2: 22,245,598	I92T	probably benign	Het
Naglu	T	A	11: 101,074,027	N313K	probably damaging	Het
Nceh1	T	C	3: 27,222,804	V92A	possibly damaging	Het
Ncf4	A	G	15: 78,250,883	T47A	probably damaging	Het
Nrp1	T	A	8: 128,460,683	F403L	probably damaging	Het
Nxph3	T	C	11: 95,511,256	T111A	possibly damaging	Het
Obscn	T	A	11: 59,038,615	E6061V	probably damaging	Het
Obsl1	C	A	1: 75,492,927	G1149W	probably damaging	Het
Olfr1162	C	T	2: 88,050,412	V71I	possibly damaging	Het
Olfr1370	T	A	13: 21,072,374	Y309F	probably benign	Het
Olfr1487	A	G	19: 13,619,485	T65A	probably benign	Het
Olfr267	A	T	4: 58,784,981	V247E	probably damaging	Het
Olfr292	A	G	7: 86,694,860	T135A	probably benign	Het
Olfr493	A	C	7: 108,346,914	D22E	probably benign	Het
Olfr814	T	A	10: 129,874,546	L70F	possibly damaging	Het
Pde9a	T	C	17: 31,455,106	V55A	probably damaging	Het
Pip4k2c	A	T	10: 127,205,821		probably null	Het
Plvap	T	C	8: 71,511,382	N112S	probably damaging	Het
Pop1	T	A	15: 34,529,858		probably null	Het
Ppip5k2	T	C	1: 97,716,553	H1113R	possibly damaging	Het
Ptprk	A	T	10: 28,573,392	I962F	probably damaging	Het
Rad51ap2	T	C	12: 11,457,042	S322P	possibly damaging	Het
Rasal1	A	G	5: 120,674,605	T565A	probably benign	Het
Rbm15	C	A	3: 107,331,155	R642S	probably damaging	Het
Rpsa	G	A	9: 120,131,003	E211K	possibly damaging	Het
Ryr3	A	G	2: 112,686,810	S3303P	probably damaging	Het
Scg2	T	A	1: 79,435,512	N458I	possibly damaging	Het
Setx	A	G	2: 29,179,643	T2487A	probably benign	Het
Slc4a5	G	A	6: 83,267,567		probably benign	Het
Slc8a2	T	A	7: 16,140,989	D387E	probably benign	Het
Smarcc2	A	G	10: 128,474,722	T407A	probably benign	Het
Snap25	A	G	2: 136,777,464	D179G	probably damaging	Het
Socs4	T	C	14: 47,289,868	S74P	probably benign	Het
Sp6	T	A	11: 97,021,925	Y155N	probably benign	Het
Srrt	C	T	5: 137,296,127		probably benign	Het
Steap1	C	T	5: 5,736,431	M335I	probably benign	Het
Stra6	A	T	9: 58,145,489	Y250F	probably benign	Het
Svil	T	C	18: 5,094,582	S1421P	probably damaging	Het
Tcea3	G	A	4: 136,271,366	C317Y	probably damaging	Het
Tmco6	T	C	18: 36,737,704	L117S	probably damaging	Het
Trp53bp1	T	C	2: 121,270,237	K89E	probably damaging	Het
Trp63	T	A	16: 25,764,302		probably benign	Het
Ube2d2a	A	G	18: 35,800,132	Y74C	probably damaging	Het
Usp19	T	G	9: 108,498,509	F885V	probably damaging	Het
Utp18	T	A	11: 93,882,177		probably benign	Het
Vmn2r116	T	C	17: 23,401,413	I707T	possibly damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Zfp318	C	T	17: 46,412,614	P1848S	probably benign	Het
Zfp984	G	T	4: 147,755,265	N376K	probably benign	Het

Other mutations in Duox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Duox2	APN	2	122283575	missense	probably benign
IGL00790:Duox2	APN	2	122292300	missense	possibly damaging	0.63
IGL01346:Duox2	APN	2	122287202	splice site	probably benign
IGL01607:Duox2	APN	2	122292319	missense	probably benign	0.00
IGL01798:Duox2	APN	2	122281908	missense	probably damaging	1.00
IGL02000:Duox2	APN	2	122290709	missense	probably benign
IGL02219:Duox2	APN	2	122294664	missense	probably benign	0.01
IGL02227:Duox2	APN	2	122285153	splice site	probably benign
IGL02276:Duox2	APN	2	122294085	missense	probably benign	0.00
IGL02447:Duox2	APN	2	122297468	missense	probably damaging	0.98
IGL02806:Duox2	APN	2	122284666	missense	probably damaging	1.00
IGL03091:Duox2	APN	2	122289474	missense	probably benign	0.03
Bedazzled	UTSW	2	122287121	missense	possibly damaging	0.76
Birthday	UTSW	2	122281871	missense	probably benign
gregorian	UTSW	2	122289345	nonsense	probably null
julian	UTSW	2	122289332	missense	probably benign	0.08
mayan	UTSW	2	122284583	missense	probably benign	0.00
minor	UTSW	2	122281496	missense	probably damaging	1.00
oaf	UTSW	2	122295176	missense	probably damaging	0.98
paltry	UTSW	2	122283060	critical splice donor site	probably null
promethius	UTSW	2	122296381	missense	probably benign
Recruit	UTSW	2	122283897	missense	possibly damaging	0.83
schlemiel	UTSW	2	122289563	missense	probably null	0.89
stumblebum	UTSW	2	122284667	missense	probably damaging	1.00
Two-bit	UTSW	2	122281002	missense	probably benign	0.42
R0049:Duox2	UTSW	2	122296686	missense	possibly damaging	0.48
R0244:Duox2	UTSW	2	122291860	missense	probably benign	0.00
R0378:Duox2	UTSW	2	122284583	missense	probably benign	0.00
R0383:Duox2	UTSW	2	122291810	critical splice donor site	probably null
R0442:Duox2	UTSW	2	122289332	missense	probably benign	0.08
R0524:Duox2	UTSW	2	122281836	missense	possibly damaging	0.80
R0560:Duox2	UTSW	2	122291554	missense	probably benign	0.04
R0562:Duox2	UTSW	2	122289599	missense	probably damaging	1.00
R0645:Duox2	UTSW	2	122292658	missense	probably damaging	1.00
R0704:Duox2	UTSW	2	122284768	missense	probably benign	0.01
R0963:Duox2	UTSW	2	122287172	missense	probably benign	0.03
R1254:Duox2	UTSW	2	122283478	missense	probably damaging	1.00
R1442:Duox2	UTSW	2	122281751	missense	probably benign	0.20
R1473:Duox2	UTSW	2	122287121	missense	possibly damaging	0.76
R1489:Duox2	UTSW	2	122293396	missense	probably benign
R1738:Duox2	UTSW	2	122293414	missense	probably damaging	1.00
R1748:Duox2	UTSW	2	122287051	missense	probably benign	0.00
R1809:Duox2	UTSW	2	122283897	missense	possibly damaging	0.83
R1843:Duox2	UTSW	2	122292258	critical splice donor site	probably null
R1903:Duox2	UTSW	2	122295351	missense	probably damaging	1.00
R1962:Duox2	UTSW	2	122297372	splice site	probably null
R2069:Duox2	UTSW	2	122287108	missense	probably benign	0.01
R2073:Duox2	UTSW	2	122295158	missense	probably damaging	1.00
R2074:Duox2	UTSW	2	122295158	missense	probably damaging	1.00
R2075:Duox2	UTSW	2	122295158	missense	probably damaging	1.00
R2085:Duox2	UTSW	2	122280967	missense	probably damaging	1.00
R3123:Duox2	UTSW	2	122281073	splice site	probably benign
R3907:Duox2	UTSW	2	122283060	critical splice donor site	probably null
R4572:Duox2	UTSW	2	122281726	missense	probably benign	0.00
R4614:Duox2	UTSW	2	122289557	missense	probably damaging	1.00
R4675:Duox2	UTSW	2	122280933	missense	probably damaging	1.00
R4770:Duox2	UTSW	2	122284916	missense	probably benign	0.01
R4817:Duox2	UTSW	2	122296515	missense	probably damaging	0.98
R4931:Duox2	UTSW	2	122296755	missense	probably benign	0.01
R5138:Duox2	UTSW	2	122297531	missense	probably damaging	1.00
R5288:Duox2	UTSW	2	122295136	missense	probably benign
R5344:Duox2	UTSW	2	122281871	missense	probably benign
R5385:Duox2	UTSW	2	122295136	missense	probably benign
R5386:Duox2	UTSW	2	122295136	missense	probably benign
R5493:Duox2	UTSW	2	122281496	missense	probably damaging	1.00
R5632:Duox2	UTSW	2	122281455	missense	probably damaging	1.00
R5742:Duox2	UTSW	2	122284921	missense	probably benign	0.00
R6228:Duox2	UTSW	2	122287193	missense	probably benign	0.38
R6380:Duox2	UTSW	2	122281002	missense	probably benign	0.42
R6398:Duox2	UTSW	2	122296370	missense	probably benign	0.06
R6409:Duox2	UTSW	2	122284667	missense	probably damaging	1.00
R6527:Duox2	UTSW	2	122294614	missense	probably benign	0.29
R6596:Duox2	UTSW	2	122285338	missense	probably benign
R6719:Duox2	UTSW	2	122284386	splice site	probably null
R6981:Duox2	UTSW	2	122291227	missense	possibly damaging	0.95
R7036:Duox2	UTSW	2	122280453	missense	probably damaging	1.00
R7073:Duox2	UTSW	2	122289307	missense	probably damaging	1.00
R7105:Duox2	UTSW	2	122289552	missense	possibly damaging	0.93
R7127:Duox2	UTSW	2	122291949	missense	probably benign	0.02
R7259:Duox2	UTSW	2	122295176	missense	probably damaging	0.98
R7698:Duox2	UTSW	2	122280764	missense	probably damaging	1.00
R7999:Duox2	UTSW	2	122283467	missense	probably benign	0.00
R8103:Duox2	UTSW	2	122287054	missense	probably benign
R8231:Duox2	UTSW	2	122289563	missense	possibly damaging	0.55
R8439:Duox2	UTSW	2	122298155	missense	probably benign
R8712:Duox2	UTSW	2	122289345	nonsense	probably null
R8887:Duox2	UTSW	2	122289563	missense	probably null	0.89
R8909:Duox2	UTSW	2	122296381	missense	probably benign
R9022:Duox2	UTSW	2	122280438	makesense	probably null
R9350:Duox2	UTSW	2	122285248	nonsense	probably null
R9727:Duox2	UTSW	2	122286517	nonsense	probably null
Z1176:Duox2	UTSW	2	122296507	missense	probably damaging	1.00
Z1177:Duox2	UTSW	2	122293452	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTGCGGGATAAGTAAGTCACAGACG -3'
(R):5'- AGACAGCCTCCACAGGTCTTGATG -3'

Sequencing Primer
(F):5'- GTCTGAGTCCGAGAATCCTTAC -3'
(R):5'- TTGATGCCAGGGGCCTAC -3'

Posted On

2013-05-23