Mutagenetix > Incidental Mutation

Incidental Mutation 'R4877:Vps72'

374971

Institutional Source

Beutler Lab

Gene Symbol

Vps72

Ensembl Gene

ENSMUSG00000008958

Gene Name

vacuolar protein sorting 72

Synonyms

YL-1, Tcfl1

MMRRC Submission

042486-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4877 (G1)

Quality Score

220

Status

Validated

Chromosome

Chromosomal Location

95111022-95123051 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

G to T at 95118187 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000009102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009102]

AlphaFold

Q62481

Predicted Effect

probably benign
Transcript: ENSMUST00000009102

SMART Domains

Protein: ENSMUSP00000009102
Gene: ENSMUSG00000008958

Domain	Start	End	E-Value	Type
Pfam:YL1	5	216	5.1e-58	PFAM
low complexity region	247	264	N/A	INTRINSIC
YL1_C	294	323	5.99e-9	SMART
low complexity region	335	358	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125548

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136076

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139296

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152333

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a shared subunit of two multi-component complexes, the histone acetyltransferase complex TRRAP/TIP60 as well as the chromatin remodeling SRCAP-containing complex. The TRRAP/TIP60 complex acetylates nucleosomal histones important for transcriptional regulation, double strand DNA break repair and apoptosis. The SRCAP-containing complex catalyzes the exchange of histone H2A with the histone variant Htz1 (H2AFZ) into nucleosomes. This protein may be responsible for binding H2AFZ, which has a role in chromosome segregation. This protein may also have a role in regulating long-term hematopoietic stem cell activity. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	A	G	11: 94,367,595	Y475H	probably damaging	Het
Adamts12	G	T	15: 11,327,701	G1388V	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Arhgap26	T	C	18: 39,296,929		probably null	Het
Atp7b	T	A	8: 22,028,601	I74F	probably damaging	Het
Bod1l	A	G	5: 41,819,994	Y1326H	probably benign	Het
Card11	T	C	5: 140,885,877	S690G	probably damaging	Het
Cbx3	A	G	6: 51,482,560	E169G	possibly damaging	Het
Cd28	A	T	1: 60,769,702	M192L	possibly damaging	Het
Chd6	T	C	2: 161,029,299		probably benign	Het
Cyp2c69	C	T	19: 39,877,612	C179Y	probably damaging	Het
Cyp7b1	A	T	3: 18,097,293	V252E	probably damaging	Het
Dcp2	G	T	18: 44,417,592	G378C	probably benign	Het
Dip2b	A	T	15: 100,160,529	I196L	possibly damaging	Het
Erbin	G	A	13: 103,850,838	P405S	probably damaging	Het
Etv1	A	G	12: 38,831,293		probably null	Het
F830104G03Rik	T	G	3: 56,890,496	K33T	unknown	Het
Fbln2	C	A	6: 91,233,495	H140Q	probably damaging	Het
Fxr1	A	G	3: 34,047,698	T109A	probably damaging	Het
Gm10110	T	C	14: 89,897,349		noncoding transcript	Het
Gm9949	C	T	18: 62,184,069		probably benign	Het
Grin2d	A	G	7: 45,854,615	L604P	probably damaging	Het
Gstcd	A	T	3: 133,005,553		probably benign	Het
Ifna16	A	G	4: 88,676,444	V138A	probably benign	Het
Itpr2	T	A	6: 146,325,205	N1314I	probably damaging	Het
Kitl	T	C	10: 100,080,866	V177A	probably damaging	Het
L3mbtl1	A	T	2: 162,948,568	Q185L	probably damaging	Het
Lhx9	T	A	1: 138,838,354	N232I	probably benign	Het
Lnx1	T	C	5: 74,628,123	R111G	probably benign	Het
Lrrc41	A	G	4: 116,079,405	I72M	probably damaging	Het
Lrriq1	T	A	10: 103,234,038	D39V	possibly damaging	Het
Lyrm7	A	G	11: 54,841,110		probably benign	Het
Lyst	T	A	13: 13,683,149	Y2508N	probably damaging	Het
Masp2	A	T	4: 148,602,871	Y70F	probably benign	Het
Mc4r	T	C	18: 66,859,338	I235V	probably benign	Het
Med12l	G	A	3: 59,244,793	V1000M	probably damaging	Het
Morc2b	T	C	17: 33,138,738	H20R	probably benign	Het
Ms4a1	A	T	19: 11,254,493	S173T	probably damaging	Het
Myh13	A	C	11: 67,337,651	D339A	probably damaging	Het
Nars	A	T	18: 64,500,572	Y542*	probably null	Het
Nectin2	G	A	7: 19,717,720	T463I	possibly damaging	Het
Nrg4	A	G	9: 55,259,395	F64L	probably benign	Het
Nrxn1	T	A	17: 91,088,177	I184F	probably benign	Het
Nxph2	C	T	2: 23,399,834	P66L	probably benign	Het
Olfr1123	C	T	2: 87,418,563	Q170*	probably null	Het
Olfr56	C	A	11: 49,134,781	F196L	probably damaging	Het
Pard3	A	T	8: 127,388,537	T579S	probably damaging	Het
Patj	A	G	4: 98,569,058	I48V	possibly damaging	Het
Paxbp1	T	C	16: 91,044,311		probably benign	Het
Pou2f3	A	T	9: 43,139,323	N235K	possibly damaging	Het
Ppp2r2c	A	G	5: 36,868,870	D17G	probably damaging	Het
Rgs8	A	G	1: 153,692,887		probably benign	Het
Rnd3	A	G	2: 51,148,750	V42A	probably damaging	Het
Rp1l1	A	G	14: 64,026,171	R247G	probably benign	Het
Sec31b	A	T	19: 44,535,733	V156D	probably damaging	Het
Slc22a2	T	A	17: 12,614,815	Y461N	possibly damaging	Het
Spag6l	T	C	16: 16,781,758	K280R	possibly damaging	Het
Spata31d1a	A	G	13: 59,702,523	L597P	probably damaging	Het
Srr	G	T	11: 74,907,780		probably benign	Het
Sry	C	G	Y: 2,662,864	Q265H	unknown	Het
Tgif1	A	C	17: 70,849,705		probably null	Het
Tle3	A	T	9: 61,373,499		probably benign	Het
Tubgcp4	A	G	2: 121,189,862	T439A	probably benign	Het
Twist1	C	T	12: 33,958,351	T125M	probably damaging	Het
Unc13a	T	A	8: 71,658,616	D317V	possibly damaging	Het
Vmn1r227	T	A	17: 20,735,145		noncoding transcript	Het
Zfp184	T	C	13: 21,960,328	S735P	possibly damaging	Het
Zfp42	A	T	8: 43,295,688	C259S	possibly damaging	Het
Zmiz2	A	G	11: 6,403,251	H678R	probably damaging	Het

Other mutations in Vps72

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02051:Vps72	APN	3	95122729	missense	possibly damaging	0.96
IGL02802:Vps72	UTSW	3	95119234	nonsense	probably null
R0135:Vps72	UTSW	3	95119197	missense	probably damaging	0.99
R0197:Vps72	UTSW	3	95122583	missense	probably damaging	0.97
R0463:Vps72	UTSW	3	95121304	missense	probably benign	0.41
R0883:Vps72	UTSW	3	95122583	missense	probably damaging	0.97
R1101:Vps72	UTSW	3	95119176	missense	probably damaging	1.00
R1484:Vps72	UTSW	3	95119151	missense	probably damaging	1.00
R1698:Vps72	UTSW	3	95118695	missense	probably benign	0.00
R1839:Vps72	UTSW	3	95119218	missense	possibly damaging	0.70
R1935:Vps72	UTSW	3	95122540	missense	probably benign	0.01
R1936:Vps72	UTSW	3	95122540	missense	probably benign	0.01
R3011:Vps72	UTSW	3	95119274	missense	probably damaging	1.00
RF018:Vps72	UTSW	3	95121408	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAACCACATTCAGAGCCTTTAGATC -3'
(R):5'- ATAGGCTTTGGTGACGACTCTG -3'

Sequencing Primer
(F):5'- ATCCCTAGTAATTGACGTGGAG -3'
(R):5'- TGGTGACGACTCTGCGCTTC -3'

Posted On

2016-03-17