Mutagenetix > Incidental Mutation

Incidental Mutation 'R4877:Kitl'

374998

Institutional Source

Beutler Lab

Gene Symbol

Kitl

Ensembl Gene

ENSMUSG00000019966

Gene Name

kit ligand

Synonyms

Gb, grizzle-belly, Mgf, SCF, SF, Sl, SLF, Steel, Steel factor, stem cell factor

MMRRC Submission

042486-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.280) question?

Stock #

R4877 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100015630-100100416 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100080866 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 177 (V177A)

Ref Sequence

ENSEMBL: ENSMUSP00000100920 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020129] [ENSMUST00000105283] [ENSMUST00000130190] [ENSMUST00000218200]

AlphaFold

P20826

Predicted Effect

probably benign
Transcript: ENSMUST00000020129

SMART Domains

Protein: ENSMUSP00000020129
Gene: ENSMUSG00000019966

Domain	Start	End	E-Value	Type
Pfam:SCF	1	176	5.7e-102	PFAM
Pfam:SCF	173	245	1.7e-36	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000105283
AA Change: V177A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000100920
Gene: ENSMUSG00000019966
AA Change: V177A

Domain	Start	End	E-Value	Type
Pfam:SCF	1	273	2.3e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130190

SMART Domains

Protein: ENSMUSP00000123360
Gene: ENSMUSG00000019966

Domain	Start	End	E-Value	Type
Pfam:SCF	43	160	1.1e-69	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000218200

Meta Mutation Damage Score

0.3178

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	A	G	11: 94,367,595	Y475H	probably damaging	Het
Adamts12	G	T	15: 11,327,701	G1388V	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Arhgap26	T	C	18: 39,296,929		probably null	Het
Atp7b	T	A	8: 22,028,601	I74F	probably damaging	Het
Bod1l	A	G	5: 41,819,994	Y1326H	probably benign	Het
Card11	T	C	5: 140,885,877	S690G	probably damaging	Het
Cbx3	A	G	6: 51,482,560	E169G	possibly damaging	Het
Cd28	A	T	1: 60,769,702	M192L	possibly damaging	Het
Chd6	T	C	2: 161,029,299		probably benign	Het
Cyp2c69	C	T	19: 39,877,612	C179Y	probably damaging	Het
Cyp7b1	A	T	3: 18,097,293	V252E	probably damaging	Het
Dcp2	G	T	18: 44,417,592	G378C	probably benign	Het
Dip2b	A	T	15: 100,160,529	I196L	possibly damaging	Het
Erbin	G	A	13: 103,850,838	P405S	probably damaging	Het
Etv1	A	G	12: 38,831,293		probably null	Het
F830104G03Rik	T	G	3: 56,890,496	K33T	unknown	Het
Fbln2	C	A	6: 91,233,495	H140Q	probably damaging	Het
Fxr1	A	G	3: 34,047,698	T109A	probably damaging	Het
Gm10110	T	C	14: 89,897,349		noncoding transcript	Het
Gm9949	C	T	18: 62,184,069		probably benign	Het
Grin2d	A	G	7: 45,854,615	L604P	probably damaging	Het
Gstcd	A	T	3: 133,005,553		probably benign	Het
Ifna16	A	G	4: 88,676,444	V138A	probably benign	Het
Itpr2	T	A	6: 146,325,205	N1314I	probably damaging	Het
L3mbtl1	A	T	2: 162,948,568	Q185L	probably damaging	Het
Lhx9	T	A	1: 138,838,354	N232I	probably benign	Het
Lnx1	T	C	5: 74,628,123	R111G	probably benign	Het
Lrrc41	A	G	4: 116,079,405	I72M	probably damaging	Het
Lrriq1	T	A	10: 103,234,038	D39V	possibly damaging	Het
Lyrm7	A	G	11: 54,841,110		probably benign	Het
Lyst	T	A	13: 13,683,149	Y2508N	probably damaging	Het
Masp2	A	T	4: 148,602,871	Y70F	probably benign	Het
Mc4r	T	C	18: 66,859,338	I235V	probably benign	Het
Med12l	G	A	3: 59,244,793	V1000M	probably damaging	Het
Morc2b	T	C	17: 33,138,738	H20R	probably benign	Het
Ms4a1	A	T	19: 11,254,493	S173T	probably damaging	Het
Myh13	A	C	11: 67,337,651	D339A	probably damaging	Het
Nars	A	T	18: 64,500,572	Y542*	probably null	Het
Nectin2	G	A	7: 19,717,720	T463I	possibly damaging	Het
Nrg4	A	G	9: 55,259,395	F64L	probably benign	Het
Nrxn1	T	A	17: 91,088,177	I184F	probably benign	Het
Nxph2	C	T	2: 23,399,834	P66L	probably benign	Het
Olfr1123	C	T	2: 87,418,563	Q170*	probably null	Het
Olfr56	C	A	11: 49,134,781	F196L	probably damaging	Het
Pard3	A	T	8: 127,388,537	T579S	probably damaging	Het
Patj	A	G	4: 98,569,058	I48V	possibly damaging	Het
Paxbp1	T	C	16: 91,044,311		probably benign	Het
Pou2f3	A	T	9: 43,139,323	N235K	possibly damaging	Het
Ppp2r2c	A	G	5: 36,868,870	D17G	probably damaging	Het
Rgs8	A	G	1: 153,692,887		probably benign	Het
Rnd3	A	G	2: 51,148,750	V42A	probably damaging	Het
Rp1l1	A	G	14: 64,026,171	R247G	probably benign	Het
Sec31b	A	T	19: 44,535,733	V156D	probably damaging	Het
Slc22a2	T	A	17: 12,614,815	Y461N	possibly damaging	Het
Spag6l	T	C	16: 16,781,758	K280R	possibly damaging	Het
Spata31d1a	A	G	13: 59,702,523	L597P	probably damaging	Het
Srr	G	T	11: 74,907,780		probably benign	Het
Sry	C	G	Y: 2,662,864	Q265H	unknown	Het
Tgif1	A	C	17: 70,849,705		probably null	Het
Tle3	A	T	9: 61,373,499		probably benign	Het
Tubgcp4	A	G	2: 121,189,862	T439A	probably benign	Het
Twist1	C	T	12: 33,958,351	T125M	probably damaging	Het
Unc13a	T	A	8: 71,658,616	D317V	possibly damaging	Het
Vmn1r227	T	A	17: 20,735,145		noncoding transcript	Het
Vps72	G	T	3: 95,118,187		probably benign	Het
Zfp184	T	C	13: 21,960,328	S735P	possibly damaging	Het
Zfp42	A	T	8: 43,295,688	C259S	possibly damaging	Het
Zmiz2	A	G	11: 6,403,251	H678R	probably damaging	Het

Other mutations in Kitl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00823:Kitl	APN	10	100087344	splice site	probably benign
IGL02066:Kitl	APN	10	100076882	missense	probably damaging	1.00
IGL03211:Kitl	APN	10	100080859	missense	probably benign	0.19
Gregory	UTSW	10	100076906	critical splice donor site	probably null
mooyah	UTSW	10	100088222	critical splice donor site	probably null
Sandycheeks	UTSW	10	100076906	critical splice donor site	probably null
R0131:Kitl	UTSW	10	100087364	missense	probably benign	0.11
R0131:Kitl	UTSW	10	100087364	missense	probably benign	0.11
R0132:Kitl	UTSW	10	100087364	missense	probably benign	0.11
R1554:Kitl	UTSW	10	100087438	missense	probably benign	0.38
R1649:Kitl	UTSW	10	100064114	missense	probably benign	0.03
R2194:Kitl	UTSW	10	100016037	critical splice donor site	probably null
R2254:Kitl	UTSW	10	100080131	critical splice donor site	probably null
R5135:Kitl	UTSW	10	100088222	critical splice donor site	probably null
R5453:Kitl	UTSW	10	100087385	missense	probably damaging	1.00
R5564:Kitl	UTSW	10	100080024	missense	possibly damaging	0.89
R5832:Kitl	UTSW	10	100080020	missense	probably damaging	1.00
R5971:Kitl	UTSW	10	100076906	critical splice donor site	probably null
R6043:Kitl	UTSW	10	100064085	missense	probably damaging	1.00
R6067:Kitl	UTSW	10	100076906	critical splice donor site	probably null
R6138:Kitl	UTSW	10	100076906	critical splice donor site	probably null
R6255:Kitl	UTSW	10	100089233	makesense	probably null
R6450:Kitl	UTSW	10	100087394	start codon destroyed	probably null	0.00
R6588:Kitl	UTSW	10	100064092	missense	probably damaging	1.00
R6951:Kitl	UTSW	10	100051852	missense	probably damaging	1.00
R7315:Kitl	UTSW	10	100016112	missense	unknown
R7368:Kitl	UTSW	10	100016081	missense	probably benign	0.02
R8010:Kitl	UTSW	10	100051903	missense	probably benign	0.22
R8234:Kitl	UTSW	10	100051846	missense	probably damaging	1.00
R9613:Kitl	UTSW	10	100080919	missense	probably damaging	1.00
U15987:Kitl	UTSW	10	100076906	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CATCTCTTGACAAAACTGAGCAGC -3'
(R):5'- GAGATCCGATTCTCCAAACCAG -3'

Sequencing Primer
(F):5'- TCTTGACAAAACTGAGCAGCTGAAC -3'
(R):5'- TCCAAACCAGATATTTAATTGTCAGG -3'

Posted On

2016-03-17