Mutagenetix > Incidental Mutation

Incidental Mutation 'R4877:Sec31b'

375030

Institutional Source

Beutler Lab

Gene Symbol

Sec31b

Ensembl Gene

ENSMUSG00000051984

Gene Name

Sec31 homolog B (S. cerevisiae)

Synonyms

LOC240667, Sec31l2

MMRRC Submission

042486-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R4877 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44516957-44545864 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 44535733 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 156 (V156D)

Ref Sequence

ENSEMBL: ENSMUSP00000064900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063632] [ENSMUST00000111985]

AlphaFold

Q3TZ89

Predicted Effect

probably damaging
Transcript: ENSMUST00000063632
AA Change: V156D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984
AA Change: V156D

Domain	Start	End	E-Value	Type
Blast:WD40	56	101	5e-18	BLAST
WD40	110	150	4.76e-6	SMART
WD40	159	197	1.53e1	SMART
WD40	200	245	1.85e0	SMART
WD40	249	289	2.15e-4	SMART
WD40	292	332	6.19e-1	SMART
low complexity region	551	561	N/A	INTRINSIC
low complexity region	822	841	N/A	INTRINSIC
low complexity region	909	929	N/A	INTRINSIC
low complexity region	1009	1018	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111985

SMART Domains

Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984

Domain	Start	End	E-Value	Type
WD40	2	40	1.53e1	SMART
WD40	43	88	1.85e0	SMART
WD40	92	132	2.15e-4	SMART
WD40	135	175	6.19e-1	SMART
Pfam:Sec16_C	394	612	1.3e-7	PFAM
low complexity region	665	684	N/A	INTRINSIC
low complexity region	752	772	N/A	INTRINSIC
low complexity region	852	861	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	A	G	11: 94,367,595	Y475H	probably damaging	Het
Adamts12	G	T	15: 11,327,701	G1388V	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Arhgap26	T	C	18: 39,296,929		probably null	Het
Atp7b	T	A	8: 22,028,601	I74F	probably damaging	Het
Bod1l	A	G	5: 41,819,994	Y1326H	probably benign	Het
Card11	T	C	5: 140,885,877	S690G	probably damaging	Het
Cbx3	A	G	6: 51,482,560	E169G	possibly damaging	Het
Cd28	A	T	1: 60,769,702	M192L	possibly damaging	Het
Chd6	T	C	2: 161,029,299		probably benign	Het
Cyp2c69	C	T	19: 39,877,612	C179Y	probably damaging	Het
Cyp7b1	A	T	3: 18,097,293	V252E	probably damaging	Het
Dcp2	G	T	18: 44,417,592	G378C	probably benign	Het
Dip2b	A	T	15: 100,160,529	I196L	possibly damaging	Het
Erbin	G	A	13: 103,850,838	P405S	probably damaging	Het
Etv1	A	G	12: 38,831,293		probably null	Het
F830104G03Rik	T	G	3: 56,890,496	K33T	unknown	Het
Fbln2	C	A	6: 91,233,495	H140Q	probably damaging	Het
Fxr1	A	G	3: 34,047,698	T109A	probably damaging	Het
Gm10110	T	C	14: 89,897,349		noncoding transcript	Het
Gm9949	C	T	18: 62,184,069		probably benign	Het
Grin2d	A	G	7: 45,854,615	L604P	probably damaging	Het
Gstcd	A	T	3: 133,005,553		probably benign	Het
Ifna16	A	G	4: 88,676,444	V138A	probably benign	Het
Itpr2	T	A	6: 146,325,205	N1314I	probably damaging	Het
Kitl	T	C	10: 100,080,866	V177A	probably damaging	Het
L3mbtl1	A	T	2: 162,948,568	Q185L	probably damaging	Het
Lhx9	T	A	1: 138,838,354	N232I	probably benign	Het
Lnx1	T	C	5: 74,628,123	R111G	probably benign	Het
Lrrc41	A	G	4: 116,079,405	I72M	probably damaging	Het
Lrriq1	T	A	10: 103,234,038	D39V	possibly damaging	Het
Lyrm7	A	G	11: 54,841,110		probably benign	Het
Lyst	T	A	13: 13,683,149	Y2508N	probably damaging	Het
Masp2	A	T	4: 148,602,871	Y70F	probably benign	Het
Mc4r	T	C	18: 66,859,338	I235V	probably benign	Het
Med12l	G	A	3: 59,244,793	V1000M	probably damaging	Het
Morc2b	T	C	17: 33,138,738	H20R	probably benign	Het
Ms4a1	A	T	19: 11,254,493	S173T	probably damaging	Het
Myh13	A	C	11: 67,337,651	D339A	probably damaging	Het
Nars	A	T	18: 64,500,572	Y542*	probably null	Het
Nectin2	G	A	7: 19,717,720	T463I	possibly damaging	Het
Nrg4	A	G	9: 55,259,395	F64L	probably benign	Het
Nrxn1	T	A	17: 91,088,177	I184F	probably benign	Het
Nxph2	C	T	2: 23,399,834	P66L	probably benign	Het
Olfr1123	C	T	2: 87,418,563	Q170*	probably null	Het
Olfr56	C	A	11: 49,134,781	F196L	probably damaging	Het
Pard3	A	T	8: 127,388,537	T579S	probably damaging	Het
Patj	A	G	4: 98,569,058	I48V	possibly damaging	Het
Paxbp1	T	C	16: 91,044,311		probably benign	Het
Pou2f3	A	T	9: 43,139,323	N235K	possibly damaging	Het
Ppp2r2c	A	G	5: 36,868,870	D17G	probably damaging	Het
Rgs8	A	G	1: 153,692,887		probably benign	Het
Rnd3	A	G	2: 51,148,750	V42A	probably damaging	Het
Rp1l1	A	G	14: 64,026,171	R247G	probably benign	Het
Slc22a2	T	A	17: 12,614,815	Y461N	possibly damaging	Het
Spag6l	T	C	16: 16,781,758	K280R	possibly damaging	Het
Spata31d1a	A	G	13: 59,702,523	L597P	probably damaging	Het
Srr	G	T	11: 74,907,780		probably benign	Het
Sry	C	G	Y: 2,662,864	Q265H	unknown	Het
Tgif1	A	C	17: 70,849,705		probably null	Het
Tle3	A	T	9: 61,373,499		probably benign	Het
Tubgcp4	A	G	2: 121,189,862	T439A	probably benign	Het
Twist1	C	T	12: 33,958,351	T125M	probably damaging	Het
Unc13a	T	A	8: 71,658,616	D317V	possibly damaging	Het
Vmn1r227	T	A	17: 20,735,145		noncoding transcript	Het
Vps72	G	T	3: 95,118,187		probably benign	Het
Zfp184	T	C	13: 21,960,328	S735P	possibly damaging	Het
Zfp42	A	T	8: 43,295,688	C259S	possibly damaging	Het
Zmiz2	A	G	11: 6,403,251	H678R	probably damaging	Het

Other mutations in Sec31b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Sec31b	APN	19	44527041	missense	probably damaging	1.00
IGL01308:Sec31b	APN	19	44523683	missense	probably benign	0.02
IGL02404:Sec31b	APN	19	44534788	missense	probably damaging	0.99
IGL02663:Sec31b	APN	19	44534278	missense	probably damaging	1.00
IGL02728:Sec31b	APN	19	44523115	missense	probably damaging	0.96
IGL02830:Sec31b	APN	19	44531703	missense	probably damaging	1.00
IGL03141:Sec31b	APN	19	44526320	splice site	probably benign
IGL03247:Sec31b	APN	19	44518940	missense	possibly damaging	0.62
R0049:Sec31b	UTSW	19	44520408	splice site	probably benign
R0137:Sec31b	UTSW	19	44534382	missense	probably damaging	1.00
R0238:Sec31b	UTSW	19	44525469	unclassified	probably benign
R0239:Sec31b	UTSW	19	44525469	unclassified	probably benign
R0468:Sec31b	UTSW	19	44518508	splice site	probably benign
R0504:Sec31b	UTSW	19	44534786	missense	probably damaging	1.00
R0565:Sec31b	UTSW	19	44524553	missense	probably damaging	1.00
R0627:Sec31b	UTSW	19	44525607	missense	probably benign
R0749:Sec31b	UTSW	19	44524506	missense	probably damaging	0.96
R0815:Sec31b	UTSW	19	44518173	nonsense	probably null
R1162:Sec31b	UTSW	19	44517648	nonsense	probably null
R1398:Sec31b	UTSW	19	44523665	missense	probably benign	0.04
R1436:Sec31b	UTSW	19	44536195	missense	probably damaging	0.99
R1538:Sec31b	UTSW	19	44518586	missense	probably benign	0.42
R1599:Sec31b	UTSW	19	44523153	missense	possibly damaging	0.92
R2044:Sec31b	UTSW	19	44536156	missense	probably benign	0.07
R2135:Sec31b	UTSW	19	44534696	missense	probably damaging	0.99
R2167:Sec31b	UTSW	19	44543353	missense	possibly damaging	0.89
R2211:Sec31b	UTSW	19	44523150	missense	probably damaging	1.00
R2938:Sec31b	UTSW	19	44536179	missense	probably damaging	0.99
R3113:Sec31b	UTSW	19	44518185	nonsense	probably null
R4110:Sec31b	UTSW	19	44524529	missense	possibly damaging	0.62
R4111:Sec31b	UTSW	19	44524529	missense	possibly damaging	0.62
R4113:Sec31b	UTSW	19	44524529	missense	possibly damaging	0.62
R4158:Sec31b	UTSW	19	44525186	missense	probably benign	0.34
R4226:Sec31b	UTSW	19	44531710	missense	probably benign
R4646:Sec31b	UTSW	19	44526621	missense	probably benign	0.00
R4732:Sec31b	UTSW	19	44532677	missense	probably damaging	1.00
R4733:Sec31b	UTSW	19	44532677	missense	probably damaging	1.00
R4795:Sec31b	UTSW	19	44531746	missense	probably benign	0.00
R5150:Sec31b	UTSW	19	44520531	missense	probably benign	0.08
R5377:Sec31b	UTSW	19	44518637	missense	probably damaging	1.00
R5381:Sec31b	UTSW	19	44534371	missense	probably damaging	1.00
R5708:Sec31b	UTSW	19	44523144	missense	probably damaging	1.00
R6002:Sec31b	UTSW	19	44535764	missense	probably benign	0.04
R6185:Sec31b	UTSW	19	44543284	missense	possibly damaging	0.77
R6675:Sec31b	UTSW	19	44523775	missense	probably benign
R6946:Sec31b	UTSW	19	44534316	missense	probably damaging	1.00
R7139:Sec31b	UTSW	19	44518936	missense	probably benign	0.00
R7237:Sec31b	UTSW	19	44517708	missense	probably damaging	1.00
R7270:Sec31b	UTSW	19	44523043	missense	probably benign	0.00
R7340:Sec31b	UTSW	19	44528722	missense	probably benign	0.00
R7505:Sec31b	UTSW	19	44543707	missense	probably damaging	1.00
R7584:Sec31b	UTSW	19	44543323	missense	probably damaging	0.99
R7584:Sec31b	UTSW	19	44531556	splice site	probably null
R7763:Sec31b	UTSW	19	44523835	critical splice acceptor site	probably null
R7777:Sec31b	UTSW	19	44523773	nonsense	probably null
R7900:Sec31b	UTSW	19	44526230	missense	probably damaging	1.00
R7952:Sec31b	UTSW	19	44520540	missense	probably benign	0.01
R8057:Sec31b	UTSW	19	44519365	missense	probably damaging	1.00
R8197:Sec31b	UTSW	19	44524516	missense	probably benign	0.25
R8739:Sec31b	UTSW	19	44519181	missense	probably benign	0.16
R8822:Sec31b	UTSW	19	44519263	missense	probably benign	0.02
R8837:Sec31b	UTSW	19	44517667	nonsense	probably null
R8916:Sec31b	UTSW	19	44532344	missense
R9069:Sec31b	UTSW	19	44519302	missense	probably damaging	0.98
R9259:Sec31b	UTSW	19	44517416	missense	probably damaging	1.00
R9493:Sec31b	UTSW	19	44520582	missense	probably damaging	1.00
RF023:Sec31b	UTSW	19	44535787	missense	probably damaging	1.00
Z1177:Sec31b	UTSW	19	44517314	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGTGACCTGTCCATCTGTGG -3'
(R):5'- GGGTCTACCAAATGCAAGCC -3'

Sequencing Primer
(F):5'- GGGGTTTTATTGCCCTCCAG -3'
(R):5'- GTCTACCAAATGCAAGCCTCCTC -3'

Posted On

2016-03-17