Incidental Mutation 'R4878:Pde1a'
ID375034
Institutional Source Beutler Lab
Gene Symbol Pde1a
Ensembl Gene ENSMUSG00000059173
Gene Namephosphodiesterase 1A, calmodulin-dependent
Synonyms
MMRRC Submission 042487-MU
Accession Numbers

Genbank: NM_001159582, NM_016744, NM_001009978, NM_001009979

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location79834453-80129458 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79878139 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 312 (S312T)
Ref Sequence ENSEMBL: ENSMUSP00000139327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090756] [ENSMUST00000102651] [ENSMUST00000102652] [ENSMUST00000102653] [ENSMUST00000102654] [ENSMUST00000102655] [ENSMUST00000183775]
Predicted Effect probably benign
Transcript: ENSMUST00000090756
AA Change: S208T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000088260
Gene: ENSMUSG00000059173
AA Change: S208T

DomainStartEndE-ValueType
Pfam:PDEase_I_N 1 29 3.4e-11 PFAM
HDc 112 276 5.19e-7 SMART
low complexity region 344 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102651
AA Change: S244T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099711
Gene: ENSMUSG00000059173
AA Change: S244T

DomainStartEndE-ValueType
Pfam:PDEase_I_N 5 65 9.3e-32 PFAM
HDc 148 312 5.19e-7 SMART
low complexity region 380 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102652
AA Change: S244T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099712
Gene: ENSMUSG00000059173
AA Change: S244T

DomainStartEndE-ValueType
Pfam:PDEase_I_N 5 65 9e-32 PFAM
HDc 148 312 5.19e-7 SMART
low complexity region 380 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102653
AA Change: S312T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099713
Gene: ENSMUSG00000059173
AA Change: S312T

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 1.2e-31 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102654
AA Change: S312T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099714
Gene: ENSMUSG00000059173
AA Change: S312T

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 1.2e-31 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102655
AA Change: S312T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099715
Gene: ENSMUSG00000059173
AA Change: S312T

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 7.8e-35 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000134739
AA Change: S279T
SMART Domains Protein: ENSMUSP00000120188
Gene: ENSMUSG00000059173
AA Change: S279T

DomainStartEndE-ValueType
Pfam:PDEase_I_N 41 101 1.4e-35 PFAM
HDc 184 348 5.19e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183775
AA Change: S312T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139327
Gene: ENSMUSG00000059173
AA Change: S312T

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 1.2e-31 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Meta Mutation Damage Score 0.0686 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cyclic nucleotide phosphodiesterases (PDEs) play a role in signal transduction by regulating intracellular cyclic nucleotide concentrations through hydrolysis of cAMP and/or cGMP to their respective nucleoside 5-prime monophosphates. Members of the PDE1 family, such as PDE1A, are Ca(2+)/calmodulin (see CALM1; MIM 114180)-dependent PDEs (CaM-PDEs) that are activated by calmodulin in the presence of Ca(2+) (Michibata et al., 2001 [PubMed 11342109]; Fidock et al., 2002 [PubMed 11747989]).[supplied by OMIM, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Pde1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Pde1a APN 2 79865670 missense probably damaging 1.00
IGL01860:Pde1a APN 2 79875284 missense probably damaging 1.00
IGL02059:Pde1a APN 2 79897077 missense possibly damaging 0.64
IGL02307:Pde1a APN 2 79906068 missense possibly damaging 0.70
IGL02376:Pde1a APN 2 79875223 splice site probably benign
IGL02569:Pde1a APN 2 79868258 missense probably benign 0.04
IGL03038:Pde1a APN 2 79887946 splice site probably benign
G5030:Pde1a UTSW 2 79887836 splice site probably benign
R0099:Pde1a UTSW 2 79868313 critical splice acceptor site probably null
R0549:Pde1a UTSW 2 79865070 missense probably damaging 1.00
R0960:Pde1a UTSW 2 79865034 splice site probably benign
R1855:Pde1a UTSW 2 79898064 critical splice donor site probably null
R1907:Pde1a UTSW 2 79868307 missense probably damaging 1.00
R1972:Pde1a UTSW 2 79865721 missense probably damaging 0.99
R2262:Pde1a UTSW 2 80128931 start gained probably benign
R4658:Pde1a UTSW 2 79898181 critical splice acceptor site probably benign
R4674:Pde1a UTSW 2 79898181 critical splice acceptor site probably benign
R4842:Pde1a UTSW 2 80128837 utr 5 prime probably benign
R5161:Pde1a UTSW 2 79878144 missense probably null 1.00
R5473:Pde1a UTSW 2 79906028 missense probably damaging 1.00
R5940:Pde1a UTSW 2 79887839 critical splice donor site probably null
R5976:Pde1a UTSW 2 79868242 nonsense probably null
R6016:Pde1a UTSW 2 79865062 missense probably benign 0.01
R6242:Pde1a UTSW 2 80128792 missense probably benign
R6248:Pde1a UTSW 2 79878201 missense probably damaging 1.00
R6609:Pde1a UTSW 2 79906140 missense probably damaging 1.00
R6858:Pde1a UTSW 2 80129158 unclassified probably benign
R7161:Pde1a UTSW 2 79865214 missense probably benign 0.00
X0025:Pde1a UTSW 2 79838930 makesense probably null
Z1176:Pde1a UTSW 2 79906028 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTAGTTTCTGTCTATCCAGCAGC -3'
(R):5'- GCAAGGTTTTCAGTGTTCAATAACG -3'

Sequencing Primer
(F):5'- TCTGTCTATCCAGCAGCAGAGATG -3'
(R):5'- CCAGTGTGATGACTACTTACTATGG -3'
Posted On2016-03-17