Incidental Mutation 'R4878:Tfpi'
ID375035
Institutional Source Beutler Lab
Gene Symbol Tfpi
Ensembl Gene ENSMUSG00000027082
Gene Nametissue factor pathway inhibitor
Synonyms
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location84432855-84476775 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 84452555 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028487] [ENSMUST00000090732] [ENSMUST00000111711] [ENSMUST00000111711] [ENSMUST00000111714] [ENSMUST00000111717] [ENSMUST00000111717] [ENSMUST00000111718] [ENSMUST00000111718] [ENSMUST00000111722] [ENSMUST00000111722] [ENSMUST00000150261]
Predicted Effect probably null
Transcript: ENSMUST00000028487
SMART Domains Protein: ENSMUSP00000028487
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 223 276 2.25e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000090732
SMART Domains Protein: ENSMUSP00000088235
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111711
SMART Domains Protein: ENSMUSP00000107340
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111711
SMART Domains Protein: ENSMUSP00000107340
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111714
SMART Domains Protein: ENSMUSP00000107343
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111717
SMART Domains Protein: ENSMUSP00000107346
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111717
SMART Domains Protein: ENSMUSP00000107346
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111718
SMART Domains Protein: ENSMUSP00000107347
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 223 276 2.25e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111718
SMART Domains Protein: ENSMUSP00000107347
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 223 276 2.25e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111722
SMART Domains Protein: ENSMUSP00000107351
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 217 270 2.25e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111722
SMART Domains Protein: ENSMUSP00000107351
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 217 270 2.25e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144775
Predicted Effect probably null
Transcript: ENSMUST00000150261
SMART Domains Protein: ENSMUSP00000122776
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KU 41 94 4.4e-25 SMART
KU 112 165 7.97e-23 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kunitz-type serine protease inhibitor that regulates the tissue factor (TF)-dependent pathway of blood coagulation. The coagulation process initiates with the formation of a factor VIIa-TF complex, which proteolytically activates additional proteases (factors IX and X) and ultimately leads to the formation of a fibrin clot. The product of this gene inhibits the activated factor X and VIIa-TF proteases in an autoregulatory loop. Inhibition of the encoded protein restores hemostasis in animal models of hemophilia. This gene encodes multiple protein isoforms that differ in their inhibitory activity, specificity and cellular localization. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutant embryos die showing hemorrhages of the yolk sac, central nervous system, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Tfpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Tfpi APN 2 84444825 nonsense probably null
IGL01860:Tfpi APN 2 84444034 missense probably benign 0.00
IGL02434:Tfpi APN 2 84452548 splice site probably benign
IGL03087:Tfpi APN 2 84444045 missense possibly damaging 0.61
I1329:Tfpi UTSW 2 84444116 missense possibly damaging 0.77
R0883:Tfpi UTSW 2 84443320 splice site probably benign
R1069:Tfpi UTSW 2 84453792 splice site probably benign
R1577:Tfpi UTSW 2 84433103 missense probably damaging 0.97
R1854:Tfpi UTSW 2 84458107 missense probably benign 0.00
R1991:Tfpi UTSW 2 84458016 splice site probably benign
R2910:Tfpi UTSW 2 84444093 missense possibly damaging 0.93
R3085:Tfpi UTSW 2 84442883 utr 3 prime probably benign
R4403:Tfpi UTSW 2 84444862 missense probably damaging 0.98
R4473:Tfpi UTSW 2 84458082 missense probably null 1.00
R5810:Tfpi UTSW 2 84434424 intron probably benign
R5949:Tfpi UTSW 2 84444748 missense probably benign 0.37
R6899:Tfpi UTSW 2 84444809 missense probably damaging 1.00
R8024:Tfpi UTSW 2 84453922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAAGCTCATGGCCCATGGAG -3'
(R):5'- TGGCATAGCATTTATAAGACCTTGC -3'

Sequencing Primer
(F):5'- TGGAGCCTTCCCAATGAACAGTG -3'
(R):5'- TGACTGGCTAAAATAACCTCTCTC -3'
Posted On2016-03-17