Incidental Mutation 'R4878:Olfr1033'
ID375036
Institutional Source Beutler Lab
Gene Symbol Olfr1033
Ensembl Gene ENSMUSG00000045392
Gene Nameolfactory receptor 1033
SynonymsGA_x6K02T2Q125-47516301-47517233, MOR199-2
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86020633-86045171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86041455 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 47 (I47V)
Ref Sequence ENSEMBL: ENSMUSP00000151539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111589] [ENSMUST00000213496] [ENSMUST00000213774] [ENSMUST00000213865] [ENSMUST00000214546] [ENSMUST00000215682] [ENSMUST00000218397]
Predicted Effect probably benign
Transcript: ENSMUST00000111589
AA Change: I47V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107216
Gene: ENSMUSG00000042796
AA Change: I47V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.4e-50 PFAM
Pfam:7tm_1 39 288 3.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213496
Predicted Effect probably benign
Transcript: ENSMUST00000213774
Predicted Effect probably benign
Transcript: ENSMUST00000213865
AA Change: I47V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000214546
AA Change: I47V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000215682
AA Change: I47V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000218397
AA Change: I47V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.2279 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Olfr1033
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Olfr1033 APN 2 86042097 missense probably damaging 1.00
IGL01745:Olfr1033 APN 2 86042037 missense possibly damaging 0.74
IGL02317:Olfr1033 APN 2 86041569 missense probably damaging 0.99
IGL02400:Olfr1033 APN 2 86042076 missense probably benign 0.00
R0692:Olfr1033 UTSW 2 86042172 missense probably benign 0.00
R1629:Olfr1033 UTSW 2 86041422 missense probably damaging 0.99
R2105:Olfr1033 UTSW 2 86041330 missense probably damaging 0.97
R2288:Olfr1033 UTSW 2 86042033 nonsense probably null
R4451:Olfr1033 UTSW 2 86041959 missense probably damaging 1.00
R4512:Olfr1033 UTSW 2 86041569 missense probably damaging 0.99
R5442:Olfr1033 UTSW 2 86041951 missense probably benign 0.29
R5867:Olfr1033 UTSW 2 86041451 missense probably benign 0.01
R7849:Olfr1033 UTSW 2 86041605 missense probably benign 0.00
R7881:Olfr1033 UTSW 2 86041470 missense probably benign 0.03
Z1088:Olfr1033 UTSW 2 86041719 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCGCTAATATAAGGAATGTTCTG -3'
(R):5'- ATTTCCACATGAACAAGGGCAATG -3'

Sequencing Primer
(F):5'- CAGAAGTGAGAAGATGCTCA -3'
(R):5'- TGAAGAAGAAGCACTGTACTAAGC -3'
Posted On2016-03-17