Incidental Mutation 'R4878:Rad51'
ID375037
Institutional Source Beutler Lab
Gene Symbol Rad51
Ensembl Gene ENSMUSG00000027323
Gene NameRAD51 recombinase
SynonymsReca, Rad51a
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119112793-119147445 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 119120492 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028795] [ENSMUST00000140939] [ENSMUST00000152327]
Predicted Effect probably benign
Transcript: ENSMUST00000028795
SMART Domains Protein: ENSMUSP00000028795
Gene: ENSMUSG00000027323

DomainStartEndE-ValueType
HhH1 58 77 1.08e0 SMART
AAA 119 306 8.27e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110828
Predicted Effect unknown
Transcript: ENSMUST00000140939
AA Change: F92L
SMART Domains Protein: ENSMUSP00000119444
Gene: ENSMUSG00000027323
AA Change: F92L

DomainStartEndE-ValueType
HhH1 58 77 2.52e-1 SMART
low complexity region 94 111 N/A INTRINSIC
Pfam:Rad51 126 178 9e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141389
Predicted Effect probably benign
Transcript: ENSMUST00000151406
SMART Domains Protein: ENSMUSP00000117939
Gene: ENSMUSG00000027323

DomainStartEndE-ValueType
Pfam:Rad51 1 196 5.4e-103 PFAM
Pfam:AAA_25 2 152 1.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152327
SMART Domains Protein: ENSMUSP00000119101
Gene: ENSMUSG00000027323

DomainStartEndE-ValueType
HhH1 58 77 1.08e0 SMART
Pfam:Rad51 83 218 2.6e-71 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51, and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with the ssDNA-binding protein RPA and RAD52, and it is thought to play roles in homologous pairing and strand transfer of DNA. This protein is also found to interact with BRCA1 and BRCA2, which may be important for the cellular response to DNA damage. BRCA2 is shown to regulate both the intracellular localization and DNA-binding ability of this protein. Loss of these controls following BRCA2 inactivation may be a key event leading to genomic instability and tumorigenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for targeted null mutations die prior to implantation, usually by the eight-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Rad51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01659:Rad51 APN 2 119118702 missense probably benign 0.44
IGL03028:Rad51 APN 2 119116314 start codon destroyed possibly damaging 0.90
R0015:Rad51 UTSW 2 119116327 missense probably benign 0.18
R0015:Rad51 UTSW 2 119116327 missense probably benign 0.18
R1723:Rad51 UTSW 2 119123814 missense probably benign 0.04
R2843:Rad51 UTSW 2 119118633 missense probably benign 0.43
R3403:Rad51 UTSW 2 119120544 intron probably benign
R4454:Rad51 UTSW 2 119131568 missense probably damaging 1.00
R4672:Rad51 UTSW 2 119123846 missense probably benign 0.22
R4945:Rad51 UTSW 2 119127148 missense probably damaging 0.99
R5575:Rad51 UTSW 2 119134433 missense probably benign 0.24
R7295:Rad51 UTSW 2 119134118 missense possibly damaging 0.94
R7711:Rad51 UTSW 2 119131590 missense probably benign 0.01
R8324:Rad51 UTSW 2 119123831 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGTAATCTCAGCAGTCTGGCC -3'
(R):5'- CTAAACAGCTAGGGGTCGAG -3'

Sequencing Primer
(F):5'- CAGCAGTCTGGCCTTATCTAAG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On2016-03-17