Incidental Mutation 'R4878:Ccndbp1'
ID375038
Institutional Source Beutler Lab
Gene Symbol Ccndbp1
Ensembl Gene ENSMUSG00000023572
Gene Namecyclin D-type binding-protein 1
Synonymsstage specific embryonic cDNA-8, Maid, DIP1, SSEC-8, GCIP
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121008403-121016904 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 121014691 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 363 (L363*)
Ref Sequence ENSEMBL: ENSMUSP00000125961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060455] [ENSMUST00000099488] [ENSMUST00000099489] [ENSMUST00000102490] [ENSMUST00000171260]
Predicted Effect probably benign
Transcript: ENSMUST00000060455
SMART Domains Protein: ENSMUSP00000062496
Gene: ENSMUSG00000023572

DomainStartEndE-ValueType
Pfam:GCIP 50 318 4.2e-93 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099488
AA Change: L363*
SMART Domains Protein: ENSMUSP00000097087
Gene: ENSMUSG00000023572
AA Change: L363*

DomainStartEndE-ValueType
Pfam:GCIP 50 311 4.8e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099489
SMART Domains Protein: ENSMUSP00000097088
Gene: ENSMUSG00000023572

DomainStartEndE-ValueType
Pfam:GCIP 3 271 3.7e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102490
SMART Domains Protein: ENSMUSP00000099548
Gene: ENSMUSG00000023216

DomainStartEndE-ValueType
Pfam:Transglut_N 6 124 5.8e-34 PFAM
TGc 260 353 3.52e-27 SMART
low complexity region 442 458 N/A INTRINSIC
Pfam:Transglut_C 475 580 8e-23 PFAM
Pfam:Transglut_C 588 686 8.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151532
Predicted Effect probably null
Transcript: ENSMUST00000171260
AA Change: L363*
SMART Domains Protein: ENSMUSP00000125961
Gene: ENSMUSG00000023572
AA Change: L363*

DomainStartEndE-ValueType
Pfam:GCIP 52 309 4.7e-74 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the interaction of its gene product with Grap2, a leukocyte-specific adaptor protein important for immune cell signaling. The protein encoded by this gene was shown to interact with cyclin D. Transfection of this gene in cells was reported to reduce the phosphorylation of Rb gene product by cyclin D-dependent protein kinase, and inhibit E2F1-mediated transcription activity. This protein was also found to interact with helix-loop-helix protein E12 and is thought to be a negative regulator of liver-specific gene expression. Several alternatively spliced variants have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a targeted null allele exhibit a delay in G1/S-phase progression of hepatocytes after partial hepatectomy and develop hepatocellular carcinomas at an advanced age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Ccndbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02305:Ccndbp1 APN 2 121011452 missense probably damaging 1.00
R0141:Ccndbp1 UTSW 2 121012422 missense probably damaging 1.00
R3774:Ccndbp1 UTSW 2 121009100 missense possibly damaging 0.80
R4490:Ccndbp1 UTSW 2 121012395 missense probably damaging 0.97
R4695:Ccndbp1 UTSW 2 121014727 unclassified probably benign
R4783:Ccndbp1 UTSW 2 121008522 missense probably benign 0.00
R4784:Ccndbp1 UTSW 2 121008522 missense probably benign 0.00
R4785:Ccndbp1 UTSW 2 121008522 missense probably benign 0.00
R5637:Ccndbp1 UTSW 2 121011684 missense probably benign 0.08
R5687:Ccndbp1 UTSW 2 121014702 unclassified probably benign
R6363:Ccndbp1 UTSW 2 121012973 missense probably damaging 1.00
R6913:Ccndbp1 UTSW 2 121009866 missense probably benign 0.01
R7192:Ccndbp1 UTSW 2 121012943 missense probably damaging 1.00
R7601:Ccndbp1 UTSW 2 121016146 missense probably damaging 0.99
R8071:Ccndbp1 UTSW 2 121014565 missense unknown
R8283:Ccndbp1 UTSW 2 121008584 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGTGCATTAAGGAGCAATCTTTG -3'
(R):5'- CCCTGCCAGTTACATCAGTGAG -3'

Sequencing Primer
(F):5'- CAGGTGAATGTGTGGACACTC -3'
(R):5'- TCAGTGAGATGAACTGGAGGTC -3'
Posted On2016-03-17