Mutagenetix > Incidental Mutations

Incidental Mutation 'R4878:Kif16b'

375040

Institutional Source

Beutler Lab

Gene Symbol

Kif16b

Ensembl Gene

ENSMUSG00000038844

Gene Name

kinesin family member 16B

Synonyms

8430434E15Rik, N-3 kinesin

MMRRC Submission

042487-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4878 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

142617474-142901531 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 142848003 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 330 (I330V)

Ref Sequence

ENSEMBL: ENSMUSP00000148731 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043589] [ENSMUST00000211861] [ENSMUST00000230763]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043589
AA Change: I330V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000042551
Gene: ENSMUSG00000038844
AA Change: I330V

Domain	Start	End	E-Value	Type
KISc	1	366	4.87e-173	SMART
FHA	477	529	1.43e-1	SMART
coiled coil region	597	809	N/A	INTRINSIC
coiled coil region	835	858	N/A	INTRINSIC
coiled coil region	941	1022	N/A	INTRINSIC
PX	1179	1281	1.58e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000211861
AA Change: I330V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000230763
AA Change: I330V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.2760

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin-like protein that may be involved in intracellular trafficking. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Chimera embryos containing a knock-out allele and derived from tetraploid rescue exhibit lethal growth arrest at the blastocyst stage with abnormal development of the primitive endoderm, epiblast epithelium, and basement membrane. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	C	A	4: 144,613,845	H47N	possibly damaging	Het
Adgrg3	A	T	8: 95,035,086	N159I	possibly damaging	Het
Agrn	A	T	4: 156,170,845	L1449Q	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Atg2a	A	T	19: 6,250,244	E694V	probably damaging	Het
Ccndbp1	T	A	2: 121,014,691	L363*	probably null	Het
Cdh16	A	T	8: 104,618,064	D478E	probably damaging	Het
Cep295	A	T	9: 15,334,956	W735R	probably benign	Het
Cnnm2	C	T	19: 46,859,083	P682S	probably benign	Het
Daam2	C	A	17: 49,460,710	R951L	probably damaging	Het
Dmxl1	T	A	18: 49,851,476	F180I	probably damaging	Het
Dnajc6	T	C	4: 101,599,034		probably benign	Het
Efemp2	A	T	19: 5,480,761		probably benign	Het
Emilin1	A	G	5: 30,917,066	D217G	probably benign	Het
Enpep	A	T	3: 129,276,771	M829K	probably benign	Het
Epb41l4a	A	G	18: 33,798,572	V623A	probably damaging	Het
Erlin2	T	A	8: 27,027,166		probably null	Het
Fbln2	T	C	6: 91,256,995		probably null	Het
Gga3	A	T	11: 115,591,321	I157N	probably damaging	Het
Gm884	A	G	11: 103,617,891		probably benign	Het
Gtpbp6	C	T	5: 110,107,311		probably benign	Het
Hps4	T	C	5: 112,375,368	V584A	probably benign	Het
Ighv1-50	T	C	12: 115,119,947	Y51C	probably benign	Het
Kif13b	T	C	14: 64,806,154	L1801P	probably benign	Het
Klb	A	T	5: 65,348,490	R27W	probably damaging	Het
Lrif1	A	T	3: 106,735,640	K169M	probably damaging	Het
Met	A	G	6: 17,549,059	D970G	probably damaging	Het
Mical3	A	T	6: 120,969,387	M1051K	possibly damaging	Het
Mios	A	G	6: 8,215,094	N97D	probably benign	Het
Msh5	G	A	17: 35,038,456	R321C	probably damaging	Het
Mybpc1	T	C	10: 88,551,430	Q473R	possibly damaging	Het
Ncoa1	C	T	12: 4,275,004	G970D	probably damaging	Het
Neb	T	C	2: 52,219,394	Y232C	probably damaging	Het
Nefh	A	G	11: 4,941,333	S429P	probably damaging	Het
Notch3	C	T	17: 32,147,085	G1014D	probably damaging	Het
Nup107	A	T	10: 117,751,418	C859S	probably benign	Het
Olfr1033	A	G	2: 86,041,455	I47V	probably benign	Het
Olfr136	T	G	17: 38,335,627	F157V	probably benign	Het
Olfr412	T	C	11: 74,364,848	Y60H	probably damaging	Het
Otud7b	T	A	3: 96,136,510		probably benign	Het
Pde1a	A	T	2: 79,878,139	S312T	probably benign	Het
Piwil1	G	T	5: 128,740,981	R94L	probably damaging	Het
Pnma2	G	A	14: 66,917,054	W309*	probably null	Het
Ppef2	A	C	5: 92,228,740		probably null	Het
Rabac1	T	A	7: 24,969,967	Q212L	possibly damaging	Het
Rad51	T	C	2: 119,120,492		probably benign	Het
Rbm48	A	T	5: 3,591,853		probably benign	Het
Rft1	C	T	14: 30,677,804	S315L	probably benign	Het
Rgs13	C	T	1: 144,171,479	M1I	probably null	Het
Rhbg	A	C	3: 88,247,453	S215A	probably benign	Het
Rufy2	A	T	10: 63,002,211	N379I	probably damaging	Het
Slc17a1	T	C	13: 23,880,654	L367P	probably damaging	Het
Slc25a39	G	A	11: 102,403,675	R308C	probably benign	Het
Smo	A	G	6: 29,753,571	T149A	probably benign	Het
Sqle	A	G	15: 59,316,085	K81E	probably benign	Het
Tfpi	A	G	2: 84,452,555		probably null	Het
Tnk2	A	G	16: 32,679,630	D572G	probably damaging	Het
Ubr5	A	T	15: 38,006,564	M1149K	probably benign	Het
Utrn	T	A	10: 12,727,758	Q626L	probably damaging	Het
Virma	T	A	4: 11,544,971	H1643Q	probably damaging	Het
Wnt3	G	T	11: 103,808,205	G46C	possibly damaging	Het
Zkscan7	G	T	9: 122,890,800	G184*	probably null	Het

Other mutations in Kif16b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Kif16b	APN	2	142848035	nonsense	probably null
IGL00499:Kif16b	APN	2	142857324	missense	probably damaging	1.00
IGL00913:Kif16b	APN	2	142704007	nonsense	probably null
IGL00971:Kif16b	APN	2	142711744	missense	probably benign	0.01
IGL01712:Kif16b	APN	2	142648471	missense	probably damaging	1.00
IGL01965:Kif16b	APN	2	142848405	missense	probably damaging	1.00
IGL02428:Kif16b	APN	2	142672360	missense	possibly damaging	0.88
IGL02576:Kif16b	APN	2	142862545	splice site	probably benign
IGL02884:Kif16b	APN	2	142702614	splice site	probably benign
IGL03065:Kif16b	APN	2	142619913	missense	probably damaging	1.00
IGL03103:Kif16b	APN	2	142862488	missense	probably damaging	1.00
IGL03403:Kif16b	APN	2	142711869	missense	probably damaging	1.00
IGL02835:Kif16b	UTSW	2	142712213	missense	probably benign	0.00
R0058:Kif16b	UTSW	2	142857305	splice site	probably null
R0058:Kif16b	UTSW	2	142857305	splice site	probably null
R0081:Kif16b	UTSW	2	142707426	splice site	probably benign
R0123:Kif16b	UTSW	2	142672375	missense	probably benign
R0134:Kif16b	UTSW	2	142672375	missense	probably benign
R0388:Kif16b	UTSW	2	142740937	missense	probably damaging	1.00
R0396:Kif16b	UTSW	2	142853659	missense	probably damaging	1.00
R0502:Kif16b	UTSW	2	142712155	missense	probably benign	0.00
R1027:Kif16b	UTSW	2	142854538	splice site	probably benign
R1674:Kif16b	UTSW	2	142712953	nonsense	probably null
R1752:Kif16b	UTSW	2	142690666	missense	probably benign	0.01
R2154:Kif16b	UTSW	2	142690580	missense	probably damaging	1.00
R2262:Kif16b	UTSW	2	142740917	missense	probably damaging	1.00
R2401:Kif16b	UTSW	2	142756122	missense	probably benign	0.04
R3951:Kif16b	UTSW	2	142707359	missense	probably benign	0.01
R4161:Kif16b	UTSW	2	142707404	missense	probably benign	0.00
R4697:Kif16b	UTSW	2	142690694	missense	probably benign	0.09
R4747:Kif16b	UTSW	2	142857426	missense	probably damaging	1.00
R4808:Kif16b	UTSW	2	142857358	missense	probably damaging	1.00
R5068:Kif16b	UTSW	2	142711707	missense	probably benign
R5120:Kif16b	UTSW	2	142848339	missense	probably damaging	1.00
R5358:Kif16b	UTSW	2	142740969	missense	probably damaging	1.00
R5821:Kif16b	UTSW	2	142702666	missense	probably damaging	1.00
R5833:Kif16b	UTSW	2	142707367	missense	probably benign
R5882:Kif16b	UTSW	2	142707258	critical splice donor site	probably null
R5974:Kif16b	UTSW	2	142857381	missense	probably damaging	1.00
R6043:Kif16b	UTSW	2	142711900	missense	probably damaging	1.00
R6230:Kif16b	UTSW	2	142849912	missense	probably damaging	1.00
R6373:Kif16b	UTSW	2	142699698	missense	possibly damaging	0.91
R6472:Kif16b	UTSW	2	142699948	intron	probably benign
R6622:Kif16b	UTSW	2	142712442	missense	probably benign	0.01
R6654:Kif16b	UTSW	2	142701277	intron	probably benign
R6912:Kif16b	UTSW	2	142700099	intron	probably benign
R7003:Kif16b	UTSW	2	142758829	missense	possibly damaging	0.95
R7265:Kif16b	UTSW	2	142714730	missense	probably damaging	1.00
R7307:Kif16b	UTSW	2	142712931	missense	probably benign	0.00
R7376:Kif16b	UTSW	2	142711872	missense	probably damaging	0.99
R7381:Kif16b	UTSW	2	142857423	missense	probably damaging	1.00
R7558:Kif16b	UTSW	2	142758826	missense	probably damaging	1.00
R7681:Kif16b	UTSW	2	142756126	missense	probably damaging	1.00
R7896:Kif16b	UTSW	2	142834075	critical splice donor site	probably null
R7956:Kif16b	UTSW	2	142862470	missense	probably benign	0.00
R8053:Kif16b	UTSW	2	142853714	missense	probably damaging	1.00
R8056:Kif16b	UTSW	2	142712842	missense	probably damaging	1.00
R8139:Kif16b	UTSW	2	142901365	missense	probably benign	0.00
R8182:Kif16b	UTSW	2	142712899	missense	possibly damaging	0.90
R8224:Kif16b	UTSW	2	142834088	missense	probably benign	0.03
R8357:Kif16b	UTSW	2	142711908	missense	probably damaging	1.00
R8359:Kif16b	UTSW	2	142711857	missense	probably benign	0.05
R8369:Kif16b	UTSW	2	142711857	missense	probably benign	0.05
R8385:Kif16b	UTSW	2	142712338	missense	probably benign	0.09
X0058:Kif16b	UTSW	2	142758861	missense	probably damaging	1.00
Z1177:Kif16b	UTSW	2	142711824	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGAACTGCCTATTCCAAACTGC -3'
(R):5'- CAAACCCAGACAGCGTGTTC -3'

Sequencing Primer
(F):5'- GCCTATTCCAAACTGCAGGTATG -3'
(R):5'- CAGACAGCGTGTTCAGGTC -3'

Posted On

2016-03-17