Incidental Mutation 'R4878:Lrif1'
ID 375043
Institutional Source Beutler Lab
Gene Symbol Lrif1
Ensembl Gene ENSMUSG00000056260
Gene Name ligand dependent nuclear receptor interacting factor 1
Synonyms 4933421E11Rik, 2010012G17Rik
MMRRC Submission 042487-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R4878 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 106592303-106643893 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106642956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 169 (K169M)
Ref Sequence ENSEMBL: ENSMUSP00000102347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098750] [ENSMUST00000098751] [ENSMUST00000106736] [ENSMUST00000127003] [ENSMUST00000130105] [ENSMUST00000150513] [ENSMUST00000154973]
AlphaFold Q8CDD9
Predicted Effect probably damaging
Transcript: ENSMUST00000098750
AA Change: K687M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096346
Gene: ENSMUSG00000056260
AA Change: K687M

DomainStartEndE-ValueType
Pfam:LRIF1 22 753 1.7e-292 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098751
AA Change: K189M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096347
Gene: ENSMUSG00000056260
AA Change: K189M

DomainStartEndE-ValueType
low complexity region 104 117 N/A INTRINSIC
coiled coil region 225 257 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106736
AA Change: K169M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102347
Gene: ENSMUSG00000056260
AA Change: K169M

DomainStartEndE-ValueType
low complexity region 84 97 N/A INTRINSIC
coiled coil region 205 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106737
SMART Domains Protein: ENSMUSP00000102348
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
Pfam:LRIF1 22 347 6.2e-145 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122928
Predicted Effect probably benign
Transcript: ENSMUST00000127003
SMART Domains Protein: ENSMUSP00000114163
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 74 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130105
SMART Domains Protein: ENSMUSP00000115110
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 49 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150513
SMART Domains Protein: ENSMUSP00000119815
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 49 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156544
Predicted Effect probably benign
Transcript: ENSMUST00000154973
SMART Domains Protein: ENSMUSP00000120350
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 49 67 N/A INTRINSIC
Meta Mutation Damage Score 0.1057 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,340,415 (GRCm39) H47N possibly damaging Het
Adgrg3 A T 8: 95,761,714 (GRCm39) N159I possibly damaging Het
Agrn A T 4: 156,255,302 (GRCm39) L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Atg2a A T 19: 6,300,274 (GRCm39) E694V probably damaging Het
Ccndbp1 T A 2: 120,845,172 (GRCm39) L363* probably null Het
Cdh16 A T 8: 105,344,696 (GRCm39) D478E probably damaging Het
Cep295 A T 9: 15,246,252 (GRCm39) W735R probably benign Het
Cnnm2 C T 19: 46,847,522 (GRCm39) P682S probably benign Het
Daam2 C A 17: 49,767,738 (GRCm39) R951L probably damaging Het
Dmxl1 T A 18: 49,984,543 (GRCm39) F180I probably damaging Het
Dnajc6 T C 4: 101,456,231 (GRCm39) probably benign Het
Efemp2 A T 19: 5,530,789 (GRCm39) probably benign Het
Emilin1 A G 5: 31,074,410 (GRCm39) D217G probably benign Het
Enpep A T 3: 129,070,420 (GRCm39) M829K probably benign Het
Epb41l4a A G 18: 33,931,625 (GRCm39) V623A probably damaging Het
Erlin2 T A 8: 27,517,194 (GRCm39) probably null Het
Fbln2 T C 6: 91,233,977 (GRCm39) probably null Het
Gga3 A T 11: 115,482,147 (GRCm39) I157N probably damaging Het
Gtpbp6 C T 5: 110,255,177 (GRCm39) probably benign Het
Hps4 T C 5: 112,523,234 (GRCm39) V584A probably benign Het
Ighv1-50 T C 12: 115,083,567 (GRCm39) Y51C probably benign Het
Kif13b T C 14: 65,043,603 (GRCm39) L1801P probably benign Het
Kif16b T C 2: 142,689,923 (GRCm39) I330V probably damaging Het
Klb A T 5: 65,505,833 (GRCm39) R27W probably damaging Het
Lrrc37 A G 11: 103,508,717 (GRCm39) probably benign Het
Met A G 6: 17,549,058 (GRCm39) D970G probably damaging Het
Mical3 A T 6: 120,946,348 (GRCm39) M1051K possibly damaging Het
Mios A G 6: 8,215,094 (GRCm39) N97D probably benign Het
Msh5 G A 17: 35,257,432 (GRCm39) R321C probably damaging Het
Mybpc1 T C 10: 88,387,292 (GRCm39) Q473R possibly damaging Het
Ncoa1 C T 12: 4,325,004 (GRCm39) G970D probably damaging Het
Neb T C 2: 52,109,406 (GRCm39) Y232C probably damaging Het
Nefh A G 11: 4,891,333 (GRCm39) S429P probably damaging Het
Notch3 C T 17: 32,366,059 (GRCm39) G1014D probably damaging Het
Nup107 A T 10: 117,587,323 (GRCm39) C859S probably benign Het
Or1d2 T C 11: 74,255,674 (GRCm39) Y60H probably damaging Het
Or2n1d T G 17: 38,646,518 (GRCm39) F157V probably benign Het
Or5m3b A G 2: 85,871,799 (GRCm39) I47V probably benign Het
Otud7b T A 3: 96,043,821 (GRCm39) probably benign Het
Pde1a A T 2: 79,708,483 (GRCm39) S312T probably benign Het
Piwil1 G T 5: 128,818,045 (GRCm39) R94L probably damaging Het
Pnma2 G A 14: 67,154,503 (GRCm39) W309* probably null Het
Ppef2 A C 5: 92,376,599 (GRCm39) probably null Het
Rabac1 T A 7: 24,669,392 (GRCm39) Q212L possibly damaging Het
Rad51 T C 2: 118,950,973 (GRCm39) probably benign Het
Rbm48 A T 5: 3,641,853 (GRCm39) probably benign Het
Rft1 C T 14: 30,399,761 (GRCm39) S315L probably benign Het
Rgs13 C T 1: 144,047,217 (GRCm39) M1I probably null Het
Rhbg A C 3: 88,154,760 (GRCm39) S215A probably benign Het
Rufy2 A T 10: 62,837,990 (GRCm39) N379I probably damaging Het
Slc17a1 T C 13: 24,064,637 (GRCm39) L367P probably damaging Het
Slc25a39 G A 11: 102,294,501 (GRCm39) R308C probably benign Het
Smo A G 6: 29,753,570 (GRCm39) T149A probably benign Het
Sqle A G 15: 59,187,934 (GRCm39) K81E probably benign Het
Tfpi A G 2: 84,282,899 (GRCm39) probably null Het
Tnk2 A G 16: 32,498,448 (GRCm39) D572G probably damaging Het
Ubr5 A T 15: 38,006,808 (GRCm39) M1149K probably benign Het
Utrn T A 10: 12,603,502 (GRCm39) Q626L probably damaging Het
Virma T A 4: 11,544,971 (GRCm39) H1643Q probably damaging Het
Wnt3 G T 11: 103,699,031 (GRCm39) G46C possibly damaging Het
Zkscan7 G T 9: 122,719,865 (GRCm39) G184* probably null Het
Other mutations in Lrif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Lrif1 APN 3 106,641,957 (GRCm39) critical splice donor site probably null
IGL01121:Lrif1 APN 3 106,642,980 (GRCm39) nonsense probably null
IGL01304:Lrif1 APN 3 106,639,049 (GRCm39) missense probably damaging 1.00
IGL02209:Lrif1 APN 3 106,639,045 (GRCm39) missense probably damaging 1.00
IGL02801:Lrif1 APN 3 106,641,930 (GRCm39) missense possibly damaging 0.89
IGL02796:Lrif1 UTSW 3 106,642,752 (GRCm39) missense probably benign 0.25
R0440:Lrif1 UTSW 3 106,641,714 (GRCm39) missense possibly damaging 0.87
R0456:Lrif1 UTSW 3 106,639,094 (GRCm39) missense probably benign 0.06
R0561:Lrif1 UTSW 3 106,639,481 (GRCm39) missense probably damaging 1.00
R1160:Lrif1 UTSW 3 106,640,033 (GRCm39) missense possibly damaging 0.95
R1720:Lrif1 UTSW 3 106,640,452 (GRCm39) missense probably damaging 1.00
R1735:Lrif1 UTSW 3 106,643,162 (GRCm39) makesense probably null
R1843:Lrif1 UTSW 3 106,640,127 (GRCm39) missense probably damaging 0.99
R2016:Lrif1 UTSW 3 106,639,522 (GRCm39) missense possibly damaging 0.94
R2200:Lrif1 UTSW 3 106,641,874 (GRCm39) missense probably damaging 0.98
R3619:Lrif1 UTSW 3 106,639,862 (GRCm39) missense probably damaging 1.00
R4750:Lrif1 UTSW 3 106,642,880 (GRCm39) missense probably benign 0.33
R4945:Lrif1 UTSW 3 106,643,069 (GRCm39) missense probably damaging 1.00
R5286:Lrif1 UTSW 3 106,639,859 (GRCm39) missense probably damaging 0.97
R5682:Lrif1 UTSW 3 106,639,884 (GRCm39) missense possibly damaging 0.70
R6149:Lrif1 UTSW 3 106,639,643 (GRCm39) missense possibly damaging 0.83
R6665:Lrif1 UTSW 3 106,642,659 (GRCm39) splice site probably null
R7011:Lrif1 UTSW 3 106,639,601 (GRCm39) missense probably damaging 1.00
R7584:Lrif1 UTSW 3 106,639,217 (GRCm39) missense probably benign 0.32
R7869:Lrif1 UTSW 3 106,640,459 (GRCm39) critical splice donor site probably null
R8247:Lrif1 UTSW 3 106,641,692 (GRCm39) missense probably damaging 1.00
R8686:Lrif1 UTSW 3 106,640,097 (GRCm39) missense probably damaging 1.00
R9001:Lrif1 UTSW 3 106,641,860 (GRCm39) missense probably benign 0.00
R9347:Lrif1 UTSW 3 106,641,674 (GRCm39) missense possibly damaging 0.71
R9612:Lrif1 UTSW 3 106,639,200 (GRCm39) missense probably damaging 0.99
Z1088:Lrif1 UTSW 3 106,639,886 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAATGCTGATGACACGGTC -3'
(R):5'- AGTTTCAGGCATCCAGTGGG -3'

Sequencing Primer
(F):5'- TGACACGGTCATGAGCATC -3'
(R):5'- TACGCAATTCTTCAAGAGCTGC -3'
Posted On 2016-03-17