Incidental Mutation 'R4878:Anks6'
ID375046
Institutional Source Beutler Lab
Gene Symbol Anks6
Ensembl Gene ENSMUSG00000066191
Gene Nameankyrin repeat and sterile alpha motif domain containing 6
Synonymsb2b1801.1Clo, LOC269533, 2210417J20Rik, SamCystin, Samd6
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4878 (G1)
Quality Score215
Status Validated
Chromosome4
Chromosomal Location47015669-47057427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 47030795 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 601 (G601S)
Ref Sequence ENSEMBL: ENSMUSP00000081665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084616] [ENSMUST00000107747] [ENSMUST00000229609]
Predicted Effect probably damaging
Transcript: ENSMUST00000084616
AA Change: G601S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081665
Gene: ENSMUSG00000066191
AA Change: G601S

DomainStartEndE-ValueType
ANK 8 37 2.39e2 SMART
ANK 68 97 5.62e-4 SMART
ANK 101 130 2.05e-6 SMART
ANK 134 163 1.9e-1 SMART
ANK 181 210 8.99e-3 SMART
ANK 215 244 7.83e-3 SMART
ANK 282 312 5.87e2 SMART
ANK 316 345 1.22e-4 SMART
ANK 350 379 3.57e-6 SMART
ANK 383 414 1.23e3 SMART
low complexity region 539 575 N/A INTRINSIC
low complexity region 619 673 N/A INTRINSIC
SAM 700 766 2.73e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107747
AA Change: G669S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103376
Gene: ENSMUSG00000066191
AA Change: G669S

DomainStartEndE-ValueType
ANK 8 37 2.39e2 SMART
ANK 68 97 5.62e-4 SMART
ANK 101 130 2.05e-6 SMART
ANK 134 163 1.9e-1 SMART
ANK 181 210 8.99e-3 SMART
ANK 215 244 7.83e-3 SMART
ANK 282 312 5.87e2 SMART
ANK 316 345 1.22e-4 SMART
ANK 350 379 3.57e-6 SMART
ANK 383 414 1.23e3 SMART
low complexity region 607 643 N/A INTRINSIC
low complexity region 687 741 N/A INTRINSIC
low complexity region 748 768 N/A INTRINSIC
Blast:SAM 769 796 1e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000229609
AA Change: G669S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and a SAM domain. It is thought that this protein may localize to the proximal region of the primary cilium, and may play a role in renal and cardiovascular development. Mutations in this gene have been shown to cause a form of nephronophthisis (NPHP16), a chronic tubulo-interstitial nephritis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart defects including TGA, DORV and septal defects associated with heterotaxy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Anks6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Anks6 APN 4 47046054 missense probably damaging 0.98
IGL01886:Anks6 APN 4 47044850 missense probably damaging 1.00
IGL02903:Anks6 APN 4 47045004 missense probably damaging 1.00
PIT4131001:Anks6 UTSW 4 47027109 missense probably damaging 1.00
R0632:Anks6 UTSW 4 47033167 missense possibly damaging 0.95
R1220:Anks6 UTSW 4 47025767 splice site probably benign
R1398:Anks6 UTSW 4 47044926 missense possibly damaging 0.75
R1479:Anks6 UTSW 4 47044874 missense probably damaging 1.00
R1519:Anks6 UTSW 4 47027152 missense probably damaging 0.99
R1713:Anks6 UTSW 4 47039726 missense probably benign 0.00
R1781:Anks6 UTSW 4 47043639 missense possibly damaging 0.87
R1853:Anks6 UTSW 4 47049387 missense probably benign 0.00
R2364:Anks6 UTSW 4 47027248 missense possibly damaging 0.93
R3790:Anks6 UTSW 4 47049212 missense probably damaging 0.97
R4432:Anks6 UTSW 4 47044905 nonsense probably null
R4700:Anks6 UTSW 4 47033127 missense possibly damaging 0.86
R4847:Anks6 UTSW 4 47033266 missense probably benign
R4876:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4877:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4879:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4961:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4962:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4968:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4970:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4971:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R5092:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R5113:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R5389:Anks6 UTSW 4 47038900 splice site probably benign
R5569:Anks6 UTSW 4 47045007 missense probably damaging 1.00
R5857:Anks6 UTSW 4 47039736 missense possibly damaging 0.92
R5977:Anks6 UTSW 4 47035748 missense probably benign 0.11
R5978:Anks6 UTSW 4 47049252 missense probably damaging 1.00
R6933:Anks6 UTSW 4 47049164 missense probably benign 0.25
R7175:Anks6 UTSW 4 47046268 intron probably null
R7454:Anks6 UTSW 4 47038919 missense unknown
R7874:Anks6 UTSW 4 47049275 missense unknown
R8146:Anks6 UTSW 4 47043605 missense unknown
Predicted Primers PCR Primer
(F):5'- GAAAGCACTGTACAGGTGTCAC -3'
(R):5'- GTGAAGACAAGCCAGCTCTTG -3'

Sequencing Primer
(F):5'- ACTGTACAGGTGTCACAGGCATC -3'
(R):5'- AAGCCAGCTCTTGCCTGC -3'
Posted On2016-03-17