Incidental Mutation 'R4878:Aadacl4'
ID375048
Institutional Source Beutler Lab
Gene Symbol Aadacl4
Ensembl Gene ENSMUSG00000070609
Gene Namearylacetamide deacetylase like 4
SynonymsGm13177
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location144613707-144623398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 144613845 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 47 (H47N)
Ref Sequence ENSEMBL: ENSMUSP00000092087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094510]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094510
AA Change: H47N

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092087
Gene: ENSMUSG00000070609
AA Change: H47N

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
transmembrane domain 43 60 N/A INTRINSIC
Pfam:Abhydrolase_3 115 285 9.6e-30 PFAM
Pfam:Abhydrolase_3 272 381 4.9e-11 PFAM
Meta Mutation Damage Score 0.5615 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Aadacl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02648:Aadacl4 APN 4 144617822 critical splice acceptor site probably null
IGL02836:Aadacl4 APN 4 144623212 missense possibly damaging 0.79
IGL02949:Aadacl4 APN 4 144617920 missense probably damaging 1.00
IGL03253:Aadacl4 APN 4 144623288 missense probably benign 0.05
white_rabbit UTSW 4 144618028 missense probably benign 0.03
R0035:Aadacl4 UTSW 4 144617941 missense probably damaging 0.98
R0268:Aadacl4 UTSW 4 144622995 missense probably benign 0.00
R1427:Aadacl4 UTSW 4 144623040 missense probably damaging 1.00
R1672:Aadacl4 UTSW 4 144623319 nonsense probably null
R2220:Aadacl4 UTSW 4 144618002 missense probably damaging 0.98
R2353:Aadacl4 UTSW 4 144623209 missense probably damaging 1.00
R2983:Aadacl4 UTSW 4 144623214 missense probably damaging 0.98
R4708:Aadacl4 UTSW 4 144623329 missense probably benign 0.01
R4911:Aadacl4 UTSW 4 144613792 missense probably damaging 1.00
R5208:Aadacl4 UTSW 4 144617828 missense probably benign 0.04
R5237:Aadacl4 UTSW 4 144623280 nonsense probably null
R5568:Aadacl4 UTSW 4 144622794 missense probably benign 0.03
R5633:Aadacl4 UTSW 4 144618028 missense probably benign 0.03
R5817:Aadacl4 UTSW 4 144622927 missense probably benign 0.04
R5848:Aadacl4 UTSW 4 144617858 missense probably benign 0.11
R5916:Aadacl4 UTSW 4 144622980 missense possibly damaging 0.93
R6736:Aadacl4 UTSW 4 144623339 missense possibly damaging 0.82
R6814:Aadacl4 UTSW 4 144623180 missense probably benign 0.07
R6872:Aadacl4 UTSW 4 144623180 missense probably benign 0.07
R6971:Aadacl4 UTSW 4 144622733 missense probably damaging 1.00
R6994:Aadacl4 UTSW 4 144623279 missense probably damaging 1.00
R7074:Aadacl4 UTSW 4 144613863 missense probably benign
R7353:Aadacl4 UTSW 4 144617920 missense probably damaging 1.00
R7837:Aadacl4 UTSW 4 144617977 missense probably damaging 1.00
R7853:Aadacl4 UTSW 4 144618022 missense probably benign 0.02
R7920:Aadacl4 UTSW 4 144617977 missense probably damaging 1.00
R7936:Aadacl4 UTSW 4 144618022 missense probably benign 0.02
X0017:Aadacl4 UTSW 4 144623016 missense probably damaging 1.00
X0065:Aadacl4 UTSW 4 144623109 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGACCTCAGATAGCAGTTTCT -3'
(R):5'- CAACTACTTCAACATCATGAGACACT -3'

Sequencing Primer
(F):5'- CCTCAGATAGCAGTTTCTCAGAGG -3'
(R):5'- AACAGGAGCCTCAGGTCATTTCTG -3'
Posted On2016-03-17