Incidental Mutation 'R4878:Rbm48'
ID375050
Institutional Source Beutler Lab
Gene Symbol Rbm48
Ensembl Gene ENSMUSG00000040302
Gene NameRNA binding motif protein 48
SynonymsC030048B08Rik
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location3583978-3596585 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 3591853 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006061] [ENSMUST00000042753] [ENSMUST00000121291] [ENSMUST00000121877] [ENSMUST00000142516] [ENSMUST00000195894]
Predicted Effect probably benign
Transcript: ENSMUST00000006061
SMART Domains Protein: ENSMUSP00000006061
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 14 99 2.4e-53 PFAM
Pfam:PEX-1N 103 179 8.6e-27 PFAM
low complexity region 508 527 N/A INTRINSIC
AAA 552 702 1.39e-10 SMART
low complexity region 754 765 N/A INTRINSIC
AAA 834 970 4.07e-17 SMART
low complexity region 1024 1044 N/A INTRINSIC
low complexity region 1051 1061 N/A INTRINSIC
low complexity region 1065 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042753
SMART Domains Protein: ENSMUSP00000040952
Gene: ENSMUSG00000040302

DomainStartEndE-ValueType
Pfam:RRM_5 104 164 6.5e-11 PFAM
low complexity region 229 239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121291
SMART Domains Protein: ENSMUSP00000113304
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 17 98 8.7e-38 PFAM
Pfam:PEX-1N 104 179 1.4e-27 PFAM
low complexity region 548 567 N/A INTRINSIC
AAA 592 742 1.39e-10 SMART
low complexity region 794 805 N/A INTRINSIC
AAA 874 1010 4.07e-17 SMART
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1091 1101 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121877
SMART Domains Protein: ENSMUSP00000112547
Gene: ENSMUSG00000040302

DomainStartEndE-ValueType
Blast:RRM 52 106 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135809
Predicted Effect probably benign
Transcript: ENSMUST00000142516
SMART Domains Protein: ENSMUSP00000116474
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
PDB:1WLF|A 1 21 5e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176000
Predicted Effect probably benign
Transcript: ENSMUST00000195894
SMART Domains Protein: ENSMUSP00000142620
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 14 99 2.5e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Rbm48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Rbm48 APN 5 3591739 missense probably damaging 0.99
IGL01085:Rbm48 APN 5 3584762 missense probably benign 0.38
IGL02605:Rbm48 APN 5 3590600 missense possibly damaging 0.53
R0811:Rbm48 UTSW 5 3591760 unclassified probably null
R0812:Rbm48 UTSW 5 3591760 unclassified probably null
R0862:Rbm48 UTSW 5 3590438 missense probably benign 0.34
R1866:Rbm48 UTSW 5 3595997 missense probably damaging 1.00
R1876:Rbm48 UTSW 5 3595259 missense probably damaging 1.00
R3029:Rbm48 UTSW 5 3596043 missense possibly damaging 0.70
R3159:Rbm48 UTSW 5 3596105 missense possibly damaging 0.87
R4385:Rbm48 UTSW 5 3590300 missense probably damaging 1.00
R5176:Rbm48 UTSW 5 3595444 missense probably damaging 1.00
R5276:Rbm48 UTSW 5 3584759 missense probably benign
R6812:Rbm48 UTSW 5 3596105 missense probably benign 0.23
R7059:Rbm48 UTSW 5 3590625 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTAGCAGTGCCTGATACAC -3'
(R):5'- TGTCTAACTCTAGCTCCAGGC -3'

Sequencing Primer
(F):5'- GTTAACACACACTTTCCATACCTTG -3'
(R):5'- CCAGATCTATATAGTGAGGCCCTG -3'
Posted On2016-03-17