Incidental Mutation 'R4878:Emilin1'
ID375051
Institutional Source Beutler Lab
Gene Symbol Emilin1
Ensembl Gene ENSMUSG00000029163
Gene Nameelastin microfibril interfacer 1
Synonyms5830419M17Rik, gp115, EMILIN-1
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R4878 (G1)
Quality Score203
Status Validated
Chromosome5
Chromosomal Location30913402-30921277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30917066 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 217 (D217G)
Ref Sequence ENSEMBL: ENSMUSP00000031055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031053] [ENSMUST00000031055] [ENSMUST00000201571] [ENSMUST00000201621] [ENSMUST00000202752]
Predicted Effect probably benign
Transcript: ENSMUST00000031053
SMART Domains Protein: ENSMUSP00000031053
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 293 5.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031055
AA Change: D217G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031055
Gene: ENSMUSG00000029163
AA Change: D217G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 57 128 1.2e-19 PFAM
low complexity region 141 155 N/A INTRINSIC
low complexity region 157 171 N/A INTRINSIC
coiled coil region 174 210 N/A INTRINSIC
coiled coil region 237 263 N/A INTRINSIC
coiled coil region 310 342 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
internal_repeat_1 422 474 9.62e-7 PROSPERO
coiled coil region 527 563 N/A INTRINSIC
low complexity region 606 627 N/A INTRINSIC
low complexity region 629 639 N/A INTRINSIC
internal_repeat_1 704 758 9.62e-7 PROSPERO
low complexity region 780 810 N/A INTRINSIC
Pfam:Collagen 813 870 3.3e-10 PFAM
Pfam:C1q 873 1008 1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166839
AA Change: T147A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201169
Predicted Effect probably benign
Transcript: ENSMUST00000201571
SMART Domains Protein: ENSMUSP00000144226
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 70 2.4e-5 PFAM
Pfam:PfkB 65 249 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201621
SMART Domains Protein: ENSMUSP00000144050
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 294 1.5e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202368
Predicted Effect probably benign
Transcript: ENSMUST00000202752
SMART Domains Protein: ENSMUSP00000143850
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 243 5.8e-18 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix glycoprotein that is characterized by an N-terminal microfibril interface domain, a coiled-coiled alpha-helical domain, a collagenous domain and a C-terminal globular C1q domain. The encoded protein associates with elastic fibers at the interface between elastin and microfibrils and may play a role in the development of elastic tissues including large blood vessels, dermis, heart and lung. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display no goss abnormalities. However, histological defects occur in the skin and aorta relating to elastin fiber abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Emilin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Emilin1 APN 5 30913902 missense probably damaging 0.97
IGL01100:Emilin1 APN 5 30918404 missense probably benign
IGL02150:Emilin1 APN 5 30920173 missense possibly damaging 0.85
IGL02416:Emilin1 APN 5 30917788 missense possibly damaging 0.92
IGL02973:Emilin1 APN 5 30920663 missense probably damaging 0.97
R0142:Emilin1 UTSW 5 30913920 missense probably benign 0.00
R0419:Emilin1 UTSW 5 30915022 missense probably damaging 1.00
R1580:Emilin1 UTSW 5 30917420 missense probably damaging 0.99
R1679:Emilin1 UTSW 5 30920199 missense probably benign 0.00
R1802:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R1803:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R1864:Emilin1 UTSW 5 30918590 missense probably damaging 1.00
R1958:Emilin1 UTSW 5 30917816 missense probably benign 0.03
R2061:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2100:Emilin1 UTSW 5 30917897 missense probably benign 0.01
R2201:Emilin1 UTSW 5 30915692 missense probably benign 0.33
R2206:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2274:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2275:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2285:Emilin1 UTSW 5 30918200 missense probably damaging 1.00
R2851:Emilin1 UTSW 5 30917165 missense probably benign 0.38
R3706:Emilin1 UTSW 5 30917822 missense possibly damaging 0.47
R4205:Emilin1 UTSW 5 30919899 unclassified probably benign
R4865:Emilin1 UTSW 5 30917784 missense possibly damaging 0.93
R4981:Emilin1 UTSW 5 30919351 missense probably benign
R5113:Emilin1 UTSW 5 30920620 missense possibly damaging 0.73
R5232:Emilin1 UTSW 5 30916979 missense probably benign 0.00
R5853:Emilin1 UTSW 5 30918622 missense probably damaging 0.98
R6358:Emilin1 UTSW 5 30918218 missense probably damaging 0.98
R6807:Emilin1 UTSW 5 30915527 missense probably benign 0.10
R6932:Emilin1 UTSW 5 30917077 missense probably damaging 1.00
R6955:Emilin1 UTSW 5 30917909 missense probably damaging 1.00
R7047:Emilin1 UTSW 5 30917078 missense probably benign 0.05
R7278:Emilin1 UTSW 5 30920660 missense probably benign 0.32
R7305:Emilin1 UTSW 5 30917089 nonsense probably null
R8087:Emilin1 UTSW 5 30917100 missense probably damaging 1.00
R8208:Emilin1 UTSW 5 30917516 missense probably damaging 1.00
R8516:Emilin1 UTSW 5 30917171 missense probably damaging 1.00
R8686:Emilin1 UTSW 5 30917696 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCTGAGCTCTGAGATCCAGC -3'
(R):5'- TTCTTCACTGGGGCCAGAAG -3'

Sequencing Primer
(F):5'- GAGATCCAGCTGCTCAGTCATC -3'
(R):5'- CACTGGGGCCAGAAGGAACTG -3'
Posted On2016-03-17