Incidental Mutation 'R4878:Emilin1'
ID 375051
Institutional Source Beutler Lab
Gene Symbol Emilin1
Ensembl Gene ENSMUSG00000029163
Gene Name elastin microfibril interfacer 1
Synonyms gp115, 5830419M17Rik, EMILIN-1
MMRRC Submission 042487-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R4878 (G1)
Quality Score 203
Status Validated
Chromosome 5
Chromosomal Location 31070746-31078621 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31074410 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 217 (D217G)
Ref Sequence ENSEMBL: ENSMUSP00000031055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031053] [ENSMUST00000031055] [ENSMUST00000201571] [ENSMUST00000201621] [ENSMUST00000202752]
AlphaFold Q99K41
Predicted Effect probably benign
Transcript: ENSMUST00000031053
SMART Domains Protein: ENSMUSP00000031053
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 293 5.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031055
AA Change: D217G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031055
Gene: ENSMUSG00000029163
AA Change: D217G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 57 128 1.2e-19 PFAM
low complexity region 141 155 N/A INTRINSIC
low complexity region 157 171 N/A INTRINSIC
coiled coil region 174 210 N/A INTRINSIC
coiled coil region 237 263 N/A INTRINSIC
coiled coil region 310 342 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
internal_repeat_1 422 474 9.62e-7 PROSPERO
coiled coil region 527 563 N/A INTRINSIC
low complexity region 606 627 N/A INTRINSIC
low complexity region 629 639 N/A INTRINSIC
internal_repeat_1 704 758 9.62e-7 PROSPERO
low complexity region 780 810 N/A INTRINSIC
Pfam:Collagen 813 870 3.3e-10 PFAM
Pfam:C1q 873 1008 1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166839
AA Change: T147A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201169
Predicted Effect probably benign
Transcript: ENSMUST00000201571
SMART Domains Protein: ENSMUSP00000144226
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 70 2.4e-5 PFAM
Pfam:PfkB 65 249 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201621
SMART Domains Protein: ENSMUSP00000144050
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 294 1.5e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202368
Predicted Effect probably benign
Transcript: ENSMUST00000202752
SMART Domains Protein: ENSMUSP00000143850
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 243 5.8e-18 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix glycoprotein that is characterized by an N-terminal microfibril interface domain, a coiled-coiled alpha-helical domain, a collagenous domain and a C-terminal globular C1q domain. The encoded protein associates with elastic fibers at the interface between elastin and microfibrils and may play a role in the development of elastic tissues including large blood vessels, dermis, heart and lung. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display no goss abnormalities. However, histological defects occur in the skin and aorta relating to elastin fiber abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,340,415 (GRCm39) H47N possibly damaging Het
Adgrg3 A T 8: 95,761,714 (GRCm39) N159I possibly damaging Het
Agrn A T 4: 156,255,302 (GRCm39) L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Atg2a A T 19: 6,300,274 (GRCm39) E694V probably damaging Het
Ccndbp1 T A 2: 120,845,172 (GRCm39) L363* probably null Het
Cdh16 A T 8: 105,344,696 (GRCm39) D478E probably damaging Het
Cep295 A T 9: 15,246,252 (GRCm39) W735R probably benign Het
Cnnm2 C T 19: 46,847,522 (GRCm39) P682S probably benign Het
Daam2 C A 17: 49,767,738 (GRCm39) R951L probably damaging Het
Dmxl1 T A 18: 49,984,543 (GRCm39) F180I probably damaging Het
Dnajc6 T C 4: 101,456,231 (GRCm39) probably benign Het
Efemp2 A T 19: 5,530,789 (GRCm39) probably benign Het
Enpep A T 3: 129,070,420 (GRCm39) M829K probably benign Het
Epb41l4a A G 18: 33,931,625 (GRCm39) V623A probably damaging Het
Erlin2 T A 8: 27,517,194 (GRCm39) probably null Het
Fbln2 T C 6: 91,233,977 (GRCm39) probably null Het
Gga3 A T 11: 115,482,147 (GRCm39) I157N probably damaging Het
Gtpbp6 C T 5: 110,255,177 (GRCm39) probably benign Het
Hps4 T C 5: 112,523,234 (GRCm39) V584A probably benign Het
Ighv1-50 T C 12: 115,083,567 (GRCm39) Y51C probably benign Het
Kif13b T C 14: 65,043,603 (GRCm39) L1801P probably benign Het
Kif16b T C 2: 142,689,923 (GRCm39) I330V probably damaging Het
Klb A T 5: 65,505,833 (GRCm39) R27W probably damaging Het
Lrif1 A T 3: 106,642,956 (GRCm39) K169M probably damaging Het
Lrrc37 A G 11: 103,508,717 (GRCm39) probably benign Het
Met A G 6: 17,549,058 (GRCm39) D970G probably damaging Het
Mical3 A T 6: 120,946,348 (GRCm39) M1051K possibly damaging Het
Mios A G 6: 8,215,094 (GRCm39) N97D probably benign Het
Msh5 G A 17: 35,257,432 (GRCm39) R321C probably damaging Het
Mybpc1 T C 10: 88,387,292 (GRCm39) Q473R possibly damaging Het
Ncoa1 C T 12: 4,325,004 (GRCm39) G970D probably damaging Het
Neb T C 2: 52,109,406 (GRCm39) Y232C probably damaging Het
Nefh A G 11: 4,891,333 (GRCm39) S429P probably damaging Het
Notch3 C T 17: 32,366,059 (GRCm39) G1014D probably damaging Het
Nup107 A T 10: 117,587,323 (GRCm39) C859S probably benign Het
Or1d2 T C 11: 74,255,674 (GRCm39) Y60H probably damaging Het
Or2n1d T G 17: 38,646,518 (GRCm39) F157V probably benign Het
Or5m3b A G 2: 85,871,799 (GRCm39) I47V probably benign Het
Otud7b T A 3: 96,043,821 (GRCm39) probably benign Het
Pde1a A T 2: 79,708,483 (GRCm39) S312T probably benign Het
Piwil1 G T 5: 128,818,045 (GRCm39) R94L probably damaging Het
Pnma2 G A 14: 67,154,503 (GRCm39) W309* probably null Het
Ppef2 A C 5: 92,376,599 (GRCm39) probably null Het
Rabac1 T A 7: 24,669,392 (GRCm39) Q212L possibly damaging Het
Rad51 T C 2: 118,950,973 (GRCm39) probably benign Het
Rbm48 A T 5: 3,641,853 (GRCm39) probably benign Het
Rft1 C T 14: 30,399,761 (GRCm39) S315L probably benign Het
Rgs13 C T 1: 144,047,217 (GRCm39) M1I probably null Het
Rhbg A C 3: 88,154,760 (GRCm39) S215A probably benign Het
Rufy2 A T 10: 62,837,990 (GRCm39) N379I probably damaging Het
Slc17a1 T C 13: 24,064,637 (GRCm39) L367P probably damaging Het
Slc25a39 G A 11: 102,294,501 (GRCm39) R308C probably benign Het
Smo A G 6: 29,753,570 (GRCm39) T149A probably benign Het
Sqle A G 15: 59,187,934 (GRCm39) K81E probably benign Het
Tfpi A G 2: 84,282,899 (GRCm39) probably null Het
Tnk2 A G 16: 32,498,448 (GRCm39) D572G probably damaging Het
Ubr5 A T 15: 38,006,808 (GRCm39) M1149K probably benign Het
Utrn T A 10: 12,603,502 (GRCm39) Q626L probably damaging Het
Virma T A 4: 11,544,971 (GRCm39) H1643Q probably damaging Het
Wnt3 G T 11: 103,699,031 (GRCm39) G46C possibly damaging Het
Zkscan7 G T 9: 122,719,865 (GRCm39) G184* probably null Het
Other mutations in Emilin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Emilin1 APN 5 31,071,246 (GRCm39) missense probably damaging 0.97
IGL01100:Emilin1 APN 5 31,075,748 (GRCm39) missense probably benign
IGL02150:Emilin1 APN 5 31,077,517 (GRCm39) missense possibly damaging 0.85
IGL02416:Emilin1 APN 5 31,075,132 (GRCm39) missense possibly damaging 0.92
IGL02973:Emilin1 APN 5 31,078,007 (GRCm39) missense probably damaging 0.97
R0142:Emilin1 UTSW 5 31,071,264 (GRCm39) missense probably benign 0.00
R0419:Emilin1 UTSW 5 31,072,366 (GRCm39) missense probably damaging 1.00
R1580:Emilin1 UTSW 5 31,074,764 (GRCm39) missense probably damaging 0.99
R1679:Emilin1 UTSW 5 31,077,543 (GRCm39) missense probably benign 0.00
R1802:Emilin1 UTSW 5 31,075,082 (GRCm39) missense possibly damaging 0.68
R1803:Emilin1 UTSW 5 31,075,082 (GRCm39) missense possibly damaging 0.68
R1864:Emilin1 UTSW 5 31,075,934 (GRCm39) missense probably damaging 1.00
R1958:Emilin1 UTSW 5 31,075,160 (GRCm39) missense probably benign 0.03
R2061:Emilin1 UTSW 5 31,075,082 (GRCm39) missense possibly damaging 0.68
R2100:Emilin1 UTSW 5 31,075,241 (GRCm39) missense probably benign 0.01
R2201:Emilin1 UTSW 5 31,073,036 (GRCm39) missense probably benign 0.33
R2206:Emilin1 UTSW 5 31,075,082 (GRCm39) missense possibly damaging 0.68
R2274:Emilin1 UTSW 5 31,075,082 (GRCm39) missense possibly damaging 0.68
R2275:Emilin1 UTSW 5 31,075,082 (GRCm39) missense possibly damaging 0.68
R2285:Emilin1 UTSW 5 31,075,544 (GRCm39) missense probably damaging 1.00
R2851:Emilin1 UTSW 5 31,074,509 (GRCm39) missense probably benign 0.38
R3706:Emilin1 UTSW 5 31,075,166 (GRCm39) missense possibly damaging 0.47
R4205:Emilin1 UTSW 5 31,077,243 (GRCm39) unclassified probably benign
R4865:Emilin1 UTSW 5 31,075,128 (GRCm39) missense possibly damaging 0.93
R4981:Emilin1 UTSW 5 31,076,695 (GRCm39) missense probably benign
R5113:Emilin1 UTSW 5 31,077,964 (GRCm39) missense possibly damaging 0.73
R5232:Emilin1 UTSW 5 31,074,323 (GRCm39) missense probably benign 0.00
R5853:Emilin1 UTSW 5 31,075,966 (GRCm39) missense probably damaging 0.98
R6358:Emilin1 UTSW 5 31,075,562 (GRCm39) missense probably damaging 0.98
R6807:Emilin1 UTSW 5 31,072,871 (GRCm39) missense probably benign 0.10
R6932:Emilin1 UTSW 5 31,074,421 (GRCm39) missense probably damaging 1.00
R6955:Emilin1 UTSW 5 31,075,253 (GRCm39) missense probably damaging 1.00
R7047:Emilin1 UTSW 5 31,074,422 (GRCm39) missense probably benign 0.05
R7278:Emilin1 UTSW 5 31,078,004 (GRCm39) missense probably benign 0.32
R7305:Emilin1 UTSW 5 31,074,433 (GRCm39) nonsense probably null
R8087:Emilin1 UTSW 5 31,074,444 (GRCm39) missense probably damaging 1.00
R8208:Emilin1 UTSW 5 31,074,860 (GRCm39) missense probably damaging 1.00
R8516:Emilin1 UTSW 5 31,074,515 (GRCm39) missense probably damaging 1.00
R8686:Emilin1 UTSW 5 31,075,040 (GRCm39) missense possibly damaging 0.85
R9224:Emilin1 UTSW 5 31,074,823 (GRCm39) missense probably damaging 1.00
R9526:Emilin1 UTSW 5 31,075,484 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGCTCTGAGATCCAGC -3'
(R):5'- TTCTTCACTGGGGCCAGAAG -3'

Sequencing Primer
(F):5'- GAGATCCAGCTGCTCAGTCATC -3'
(R):5'- CACTGGGGCCAGAAGGAACTG -3'
Posted On 2016-03-17