Incidental Mutation 'R4878:Klb'
ID375052
Institutional Source Beutler Lab
Gene Symbol Klb
Ensembl Gene ENSMUSG00000029195
Gene Nameklotho beta
SynonymsbetaKlotho
MMRRC Submission 042487-MU
Accession Numbers

Genbank: NM_031180.2; Ensembl: ENSMUST00000031096;

MGI:1932466

Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location65348314-65384007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65348490 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 27 (R27W)
Ref Sequence ENSEMBL: ENSMUSP00000145091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031096] [ENSMUST00000205084]
Predicted Effect probably damaging
Transcript: ENSMUST00000031096
AA Change: R27W

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031096
Gene: ENSMUSG00000029195
AA Change: R27W

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 385 8.8e-96 PFAM
Pfam:Glyco_hydro_1 374 506 1.7e-31 PFAM
Pfam:Glyco_hydro_1 515 965 6.3e-80 PFAM
transmembrane domain 995 1017 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203333
Predicted Effect probably damaging
Transcript: ENSMUST00000205084
AA Change: R27W

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145091
Gene: ENSMUSG00000029195
AA Change: R27W

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 360 8.6e-94 PFAM
Meta Mutation Damage Score 0.2579 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype Strain: 3587748
PHENOTYPE: Homozygous null mice display increased bile acid synthesis and excretion, resistance to gallstone formation, and slightly decreased body weight. Mice homozygous for a knock-out allele or a conditional allele activated in adipose tissue exhibit resistanceto FGF21-induced metabolic disruptions. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Klb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Klb APN 5 65372374 missense possibly damaging 0.90
IGL00821:Klb APN 5 65372149 missense probably damaging 1.00
IGL01082:Klb APN 5 65375940 missense possibly damaging 0.71
IGL01637:Klb APN 5 65375679 critical splice acceptor site probably null
IGL02098:Klb APN 5 65379885 missense probably benign 0.21
IGL03113:Klb APN 5 65383470 missense probably benign 0.00
1mM(1):Klb UTSW 5 65348650 missense probably damaging 1.00
P0016:Klb UTSW 5 65379923 nonsense probably null
R0268:Klb UTSW 5 65348837 missense probably benign 0.02
R0383:Klb UTSW 5 65372499 splice site probably null
R0676:Klb UTSW 5 65379055 missense probably damaging 1.00
R0735:Klb UTSW 5 65379727 missense probably benign
R0972:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1051:Klb UTSW 5 65379327 missense probably damaging 1.00
R1168:Klb UTSW 5 65378974 missense probably damaging 1.00
R1372:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1446:Klb UTSW 5 65348995 missense probably damaging 1.00
R1696:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1743:Klb UTSW 5 65375861 missense probably damaging 0.99
R1801:Klb UTSW 5 65349235 missense probably null 0.90
R1804:Klb UTSW 5 65379853 missense probably damaging 1.00
R1848:Klb UTSW 5 65348837 missense probably benign 0.02
R1967:Klb UTSW 5 65372074 missense probably damaging 0.98
R3420:Klb UTSW 5 65372142 missense probably damaging 1.00
R4397:Klb UTSW 5 65380039 missense probably damaging 1.00
R4490:Klb UTSW 5 65375794 missense probably benign 0.02
R4491:Klb UTSW 5 65375794 missense probably benign 0.02
R4547:Klb UTSW 5 65379928 missense probably benign 0.00
R5269:Klb UTSW 5 65348797 missense probably damaging 1.00
R5418:Klb UTSW 5 65383470 missense probably benign 0.00
R5453:Klb UTSW 5 65383385 missense probably benign 0.08
R5541:Klb UTSW 5 65379234 missense probably benign 0.27
R5672:Klb UTSW 5 65379949 missense possibly damaging 0.82
R5841:Klb UTSW 5 65379324 nonsense probably null
R6088:Klb UTSW 5 65349013 missense probably benign 0.07
R6807:Klb UTSW 5 65379534 missense probably damaging 1.00
R6955:Klb UTSW 5 65379088 nonsense probably null
R7068:Klb UTSW 5 65379340 missense probably damaging 1.00
R7284:Klb UTSW 5 65383478 missense probably benign 0.01
R7322:Klb UTSW 5 65383364 missense probably benign 0.44
R7346:Klb UTSW 5 65348631 nonsense probably null
R7366:Klb UTSW 5 65372431 missense probably damaging 1.00
R8134:Klb UTSW 5 65383615 missense probably benign 0.00
R8243:Klb UTSW 5 65378995 missense possibly damaging 0.65
Z1177:Klb UTSW 5 65348741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTCATGACCCCATCCTAAG -3'
(R):5'- TCCACTTGAAATGCTCCGGTC -3'

Sequencing Primer
(F):5'- TAAGTCTCCCGATCCAGGC -3'
(R):5'- CGCCCCAGGAAAAGTTTTTAG -3'
Posted On2016-03-17