Incidental Mutation 'R4878:Gtpbp6'
ID375055
Institutional Source Beutler Lab
Gene Symbol Gtpbp6
Ensembl Gene ENSMUSG00000033434
Gene NameGTP binding protein 6 (putative)
SynonymsPgbpll, pgpl
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110103975-110108197 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 110107311 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077220] [ENSMUST00000086686] [ENSMUST00000086687] [ENSMUST00000112528] [ENSMUST00000112534] [ENSMUST00000135409] [ENSMUST00000140538] [ENSMUST00000147631]
Predicted Effect probably benign
Transcript: ENSMUST00000077220
SMART Domains Protein: ENSMUSP00000076458
Gene: ENSMUSG00000033434

DomainStartEndE-ValueType
low complexity region 50 83 N/A INTRINSIC
Pfam:GTP-bdg_N 107 198 9.1e-15 PFAM
Pfam:GTP-bdg_M 200 279 1.9e-17 PFAM
Pfam:MMR_HSR1 286 404 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086686
SMART Domains Protein: ENSMUSP00000083891
Gene: ENSMUSG00000023284

DomainStartEndE-ValueType
KRAB 6 66 3.75e-28 SMART
low complexity region 147 159 N/A INTRINSIC
ZnF_C2H2 200 222 1.36e-2 SMART
ZnF_C2H2 228 250 4.38e1 SMART
ZnF_C2H2 305 327 1.18e-2 SMART
ZnF_C2H2 333 355 5.14e-3 SMART
ZnF_C2H2 361 383 9.73e-4 SMART
ZnF_C2H2 389 411 4.99e1 SMART
ZnF_C2H2 443 465 5.4e1 SMART
ZnF_C2H2 471 493 1.3e-4 SMART
ZnF_C2H2 499 521 4.24e-4 SMART
ZnF_C2H2 527 549 1.95e-3 SMART
ZnF_C2H2 555 577 2.09e-3 SMART
ZnF_C2H2 583 605 1.2e-3 SMART
ZnF_C2H2 611 633 1.79e-2 SMART
ZnF_C2H2 639 661 2.53e-2 SMART
ZnF_C2H2 667 689 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086687
SMART Domains Protein: ENSMUSP00000083892
Gene: ENSMUSG00000064247

DomainStartEndE-ValueType
SCOP:d2ptd__ 48 355 1e-70 SMART
PDB:1AOD|A 57 228 1e-12 PDB
Blast:PLCXc 70 228 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112528
SMART Domains Protein: ENSMUSP00000108147
Gene: ENSMUSG00000023284

DomainStartEndE-ValueType
KRAB 6 66 3.75e-28 SMART
low complexity region 147 159 N/A INTRINSIC
ZnF_C2H2 200 222 1.36e-2 SMART
ZnF_C2H2 228 250 4.38e1 SMART
ZnF_C2H2 305 327 1.18e-2 SMART
ZnF_C2H2 333 355 5.14e-3 SMART
ZnF_C2H2 361 383 9.73e-4 SMART
ZnF_C2H2 389 411 4.99e1 SMART
ZnF_C2H2 443 465 5.4e1 SMART
ZnF_C2H2 471 493 1.3e-4 SMART
ZnF_C2H2 499 521 4.24e-4 SMART
ZnF_C2H2 527 549 1.95e-3 SMART
ZnF_C2H2 555 577 2.09e-3 SMART
ZnF_C2H2 583 605 1.2e-3 SMART
ZnF_C2H2 611 633 1.79e-2 SMART
ZnF_C2H2 639 661 2.53e-2 SMART
ZnF_C2H2 667 689 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112534
SMART Domains Protein: ENSMUSP00000108153
Gene: ENSMUSG00000064247

DomainStartEndE-ValueType
SCOP:d2ptd__ 1 111 2e-21 SMART
PDB:1AOD|A 7 95 3e-6 PDB
Blast:PLCXc 15 121 4e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131918
Predicted Effect unknown
Transcript: ENSMUST00000135409
AA Change: G5E
SMART Domains Protein: ENSMUSP00000117817
Gene: ENSMUSG00000033434
AA Change: G5E

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
coiled coil region 185 218 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144089
Predicted Effect probably benign
Transcript: ENSMUST00000140538
Predicted Effect probably benign
Transcript: ENSMUST00000147631
SMART Domains Protein: ENSMUSP00000122236
Gene: ENSMUSG00000023284

DomainStartEndE-ValueType
KRAB 6 66 3.75e-28 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTP binding protein and is located in the pseudoautosomal region (PAR) at the end of the short arms of the X and Y chromosomes. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Gtpbp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Gtpbp6 APN 5 110104379 missense probably benign 0.08
IGL03330:Gtpbp6 APN 5 110107063 missense possibly damaging 0.95
R0457:Gtpbp6 UTSW 5 110106742 missense probably damaging 1.00
R1424:Gtpbp6 UTSW 5 110104289 unclassified probably null
R2012:Gtpbp6 UTSW 5 110104924 missense probably damaging 0.98
R2048:Gtpbp6 UTSW 5 110107065 missense probably damaging 1.00
R4520:Gtpbp6 UTSW 5 110107859 missense probably benign 0.41
R4629:Gtpbp6 UTSW 5 110106908 missense possibly damaging 0.95
R4762:Gtpbp6 UTSW 5 110104320 missense probably damaging 1.00
R5050:Gtpbp6 UTSW 5 110104701 unclassified probably benign
R5174:Gtpbp6 UTSW 5 110108117 missense possibly damaging 0.91
R5327:Gtpbp6 UTSW 5 110106904 missense probably damaging 1.00
R5450:Gtpbp6 UTSW 5 110107125 missense probably damaging 0.99
R5685:Gtpbp6 UTSW 5 110104939 missense probably damaging 1.00
R5773:Gtpbp6 UTSW 5 110106891 missense possibly damaging 0.94
R5793:Gtpbp6 UTSW 5 110107228 missense probably benign 0.01
R7205:Gtpbp6 UTSW 5 110104612 missense probably damaging 1.00
R7263:Gtpbp6 UTSW 5 110104049 missense probably benign 0.01
R7623:Gtpbp6 UTSW 5 110105084 missense probably damaging 1.00
R7790:Gtpbp6 UTSW 5 110104386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGAAAGTTGCCCTTGCC -3'
(R):5'- GGGGCGGGACTATCCTAAATTTG -3'

Sequencing Primer
(F):5'- AGTTGCCCTTGCCGAACAC -3'
(R):5'- AGCTTTGGATCATGGCCT -3'
Posted On2016-03-17