Incidental Mutation 'R4878:Erlin2'
ID375064
Institutional Source Beutler Lab
Gene Symbol Erlin2
Ensembl Gene ENSMUSG00000031483
Gene NameER lipid raft associated 2
SynonymsSpfh2
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location27023261-27040328 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 27027166 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033873] [ENSMUST00000209520] [ENSMUST00000209563] [ENSMUST00000209563] [ENSMUST00000209795] [ENSMUST00000209795] [ENSMUST00000209976] [ENSMUST00000209976] [ENSMUST00000211043] [ENSMUST00000211043] [ENSMUST00000211233]
AlphaFold Q8BFZ9
Predicted Effect probably null
Transcript: ENSMUST00000033873
SMART Domains Protein: ENSMUSP00000033873
Gene: ENSMUSG00000031483

DomainStartEndE-ValueType
PHB 21 187 1.62e-36 SMART
low complexity region 235 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209504
Predicted Effect probably null
Transcript: ENSMUST00000209520
Predicted Effect probably null
Transcript: ENSMUST00000209563
Predicted Effect probably null
Transcript: ENSMUST00000209563
Predicted Effect probably null
Transcript: ENSMUST00000209795
Predicted Effect probably null
Transcript: ENSMUST00000209795
Predicted Effect probably null
Transcript: ENSMUST00000209976
Predicted Effect probably null
Transcript: ENSMUST00000209976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210445
Predicted Effect probably null
Transcript: ENSMUST00000211043
Predicted Effect probably null
Transcript: ENSMUST00000211043
Predicted Effect probably benign
Transcript: ENSMUST00000211233
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SPFH domain-containing family of lipid raft-associated proteins. The encoded protein is localized to lipid rafts of the endoplasmic reticulum and plays a critical role in inositol 1,4,5-trisphosphate (IP3) signaling by mediating ER-associated degradation of activated IP3 receptors. Mutations in this gene are a cause of spastic paraplegia-18 (SPG18). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Erlin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Erlin2 APN 8 27036548 missense probably benign
IGL01534:Erlin2 APN 8 27031957 nonsense probably null
IGL02719:Erlin2 APN 8 27029675 unclassified probably benign
R0193:Erlin2 UTSW 8 27031764 missense possibly damaging 0.82
R4479:Erlin2 UTSW 8 27025099 missense probably benign 0.02
R4965:Erlin2 UTSW 8 27029595 missense probably damaging 0.99
R5082:Erlin2 UTSW 8 27033407 missense probably damaging 0.98
R5939:Erlin2 UTSW 8 27036526 missense probably benign 0.24
R6172:Erlin2 UTSW 8 27036095 critical splice donor site probably null
R6705:Erlin2 UTSW 8 27036440 missense probably damaging 1.00
R7033:Erlin2 UTSW 8 27031764 missense probably benign 0.03
R7537:Erlin2 UTSW 8 27031772 critical splice donor site probably null
R8161:Erlin2 UTSW 8 27028942 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGATGGGTGGCCTTAAGTC -3'
(R):5'- GAGAGAATCCTTAAGTCTGTCAATG -3'

Sequencing Primer
(F):5'- TGCTGGGACCCTTTAATAGAGACAC -3'
(R):5'- ATCCTTAAGTCTGTCAATGAAAAGG -3'
Posted On2016-03-17