Incidental Mutation 'R4878:Zkscan7'
ID375068
Institutional Source Beutler Lab
Gene Symbol Zkscan7
Ensembl Gene ENSMUSG00000063488
Gene Namezinc finger with KRAB and SCAN domains 7
SynonymsZfp167
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location122885685-122898618 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 122890800 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 184 (G184*)
Ref Sequence ENSEMBL: ENSMUSP00000150648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063980] [ENSMUST00000215872]
Predicted Effect probably null
Transcript: ENSMUST00000063980
AA Change: G184*
SMART Domains Protein: ENSMUSP00000071695
Gene: ENSMUSG00000063488
AA Change: G184*

DomainStartEndE-ValueType
SCAN 45 156 1.18e-65 SMART
ZnF_C2H2 350 372 5.59e-4 SMART
ZnF_C2H2 378 400 3.69e-4 SMART
ZnF_C2H2 434 456 8.4e1 SMART
ZnF_C2H2 487 509 4.24e-4 SMART
ZnF_C2H2 515 537 8.34e-3 SMART
ZnF_C2H2 543 565 7.37e-4 SMART
ZnF_C2H2 571 593 1.92e-2 SMART
ZnF_C2H2 599 621 1.13e-4 SMART
ZnF_C2H2 627 649 2.24e-3 SMART
ZnF_C2H2 655 677 4.17e-3 SMART
ZnF_C2H2 683 705 1.04e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214426
Predicted Effect probably null
Transcript: ENSMUST00000215872
AA Change: G184*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Other mutations in Zkscan7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Zkscan7 APN 9 122895594 missense possibly damaging 0.95
IGL01650:Zkscan7 APN 9 122894827 missense probably benign
IGL01905:Zkscan7 APN 9 122890761 missense possibly damaging 0.93
IGL02466:Zkscan7 APN 9 122888885 missense probably damaging 0.98
R0310:Zkscan7 UTSW 9 122888893 nonsense probably null
R0355:Zkscan7 UTSW 9 122888807 missense probably damaging 1.00
R0477:Zkscan7 UTSW 9 122890809 splice site probably null
R1276:Zkscan7 UTSW 9 122890723 missense probably damaging 0.98
R1426:Zkscan7 UTSW 9 122895163 missense probably benign
R2055:Zkscan7 UTSW 9 122888937 missense probably damaging 1.00
R2195:Zkscan7 UTSW 9 122895621 missense possibly damaging 0.73
R2354:Zkscan7 UTSW 9 122894827 missense probably benign
R5106:Zkscan7 UTSW 9 122896133 unclassified probably benign
R6266:Zkscan7 UTSW 9 122895234 nonsense probably null
R6299:Zkscan7 UTSW 9 122888717 missense probably damaging 1.00
R6513:Zkscan7 UTSW 9 122896105 missense probably benign 0.00
R6881:Zkscan7 UTSW 9 122888701 missense possibly damaging 0.96
R7640:Zkscan7 UTSW 9 122896056 missense possibly damaging 0.71
R7920:Zkscan7 UTSW 9 122895909 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCCTTCAGAATGCACTTAGTACC -3'
(R):5'- AGCGGTACACAGTGGTACATG -3'

Sequencing Primer
(F):5'- TCAGAATGCACTTAGTACCCAGTTC -3'
(R):5'- TACACAGTGGTACATGCTTGAG -3'
Posted On2016-03-17