Mutagenetix > Incidental Mutations

Incidental Mutation 'R4878:Mybpc1'

375071

Institutional Source

Beutler Lab

Gene Symbol

Mybpc1

Ensembl Gene

ENSMUSG00000020061

Gene Name

myosin binding protein C, slow-type

Synonyms

8030451F13Rik, Slow-type C-protein

MMRRC Submission

042487-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.762) question?

Stock #

R4878 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88518279-88605152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88551430 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 473 (Q473R)

Ref Sequence

ENSEMBL: ENSMUSP00000112615 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]

Predicted Effect

probably benign
Transcript: ENSMUST00000119185
AA Change: Q459R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: Q459R

Domain	Start	End	E-Value	Type
IG	51	147	1.96e-6	SMART
low complexity region	221	233	N/A	INTRINSIC
IG	246	325	4.53e-2	SMART
IG	335	416	1.13e-2	SMART
IG	426	506	6.97e-3	SMART
IG	519	604	2.83e-3	SMART
FN3	607	690	4.28e-10	SMART
FN3	705	788	1.49e-9	SMART
low complexity region	800	812	N/A	INTRINSIC
IG	815	898	9.06e-2	SMART
FN3	901	983	2.06e-12	SMART
IGc2	1028	1095	1.88e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121629
AA Change: Q473R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: Q473R

Domain	Start	End	E-Value	Type
low complexity region	8	27	N/A	INTRINSIC
IG	65	161	1.96e-6	SMART
low complexity region	235	247	N/A	INTRINSIC
IG	260	339	4.53e-2	SMART
IG	349	430	1.13e-2	SMART
IG	440	520	6.97e-3	SMART
IG	533	618	2.83e-3	SMART
FN3	621	704	4.28e-10	SMART
FN3	719	802	1.49e-9	SMART
low complexity region	814	826	N/A	INTRINSIC
IG	829	912	9.06e-2	SMART
FN3	915	997	2.06e-12	SMART
IGc2	1042	1109	1.88e-8	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000156573
AA Change: Q98R

SMART Domains

Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061
AA Change: Q98R

Domain	Start	End	E-Value	Type
PDB:1X44\|A	2	58	1e-26	PDB
IG	66	146	6.97e-3	SMART
IG	159	244	2.83e-3	SMART
FN3	247	330	4.28e-10	SMART
FN3	345	446	1.6e-9	SMART
low complexity region	458	470	N/A	INTRINSIC
IG	473	556	9.06e-2	SMART
FN3	559	617	8.17e0	SMART

Meta Mutation Damage Score

0.0856

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	C	A	4: 144,613,845	H47N	possibly damaging	Het
Adgrg3	A	T	8: 95,035,086	N159I	possibly damaging	Het
Agrn	A	T	4: 156,170,845	L1449Q	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Atg2a	A	T	19: 6,250,244	E694V	probably damaging	Het
Ccndbp1	T	A	2: 121,014,691	L363*	probably null	Het
Cdh16	A	T	8: 104,618,064	D478E	probably damaging	Het
Cep295	A	T	9: 15,334,956	W735R	probably benign	Het
Cnnm2	C	T	19: 46,859,083	P682S	probably benign	Het
Daam2	C	A	17: 49,460,710	R951L	probably damaging	Het
Dmxl1	T	A	18: 49,851,476	F180I	probably damaging	Het
Dnajc6	T	C	4: 101,599,034		probably benign	Het
Efemp2	A	T	19: 5,480,761		probably benign	Het
Emilin1	A	G	5: 30,917,066	D217G	probably benign	Het
Enpep	A	T	3: 129,276,771	M829K	probably benign	Het
Epb41l4a	A	G	18: 33,798,572	V623A	probably damaging	Het
Erlin2	T	A	8: 27,027,166		probably null	Het
Fbln2	T	C	6: 91,256,995		probably null	Het
Gga3	A	T	11: 115,591,321	I157N	probably damaging	Het
Gm884	A	G	11: 103,617,891		probably benign	Het
Gtpbp6	C	T	5: 110,107,311		probably benign	Het
Hps4	T	C	5: 112,375,368	V584A	probably benign	Het
Ighv1-50	T	C	12: 115,119,947	Y51C	probably benign	Het
Kif13b	T	C	14: 64,806,154	L1801P	probably benign	Het
Kif16b	T	C	2: 142,848,003	I330V	probably damaging	Het
Klb	A	T	5: 65,348,490	R27W	probably damaging	Het
Lrif1	A	T	3: 106,735,640	K169M	probably damaging	Het
Met	A	G	6: 17,549,059	D970G	probably damaging	Het
Mical3	A	T	6: 120,969,387	M1051K	possibly damaging	Het
Mios	A	G	6: 8,215,094	N97D	probably benign	Het
Msh5	G	A	17: 35,038,456	R321C	probably damaging	Het
Ncoa1	C	T	12: 4,275,004	G970D	probably damaging	Het
Neb	T	C	2: 52,219,394	Y232C	probably damaging	Het
Nefh	A	G	11: 4,941,333	S429P	probably damaging	Het
Notch3	C	T	17: 32,147,085	G1014D	probably damaging	Het
Nup107	A	T	10: 117,751,418	C859S	probably benign	Het
Olfr1033	A	G	2: 86,041,455	I47V	probably benign	Het
Olfr136	T	G	17: 38,335,627	F157V	probably benign	Het
Olfr412	T	C	11: 74,364,848	Y60H	probably damaging	Het
Otud7b	T	A	3: 96,136,510		probably benign	Het
Pde1a	A	T	2: 79,878,139	S312T	probably benign	Het
Piwil1	G	T	5: 128,740,981	R94L	probably damaging	Het
Pnma2	G	A	14: 66,917,054	W309*	probably null	Het
Ppef2	A	C	5: 92,228,740		probably null	Het
Rabac1	T	A	7: 24,969,967	Q212L	possibly damaging	Het
Rad51	T	C	2: 119,120,492		probably benign	Het
Rbm48	A	T	5: 3,591,853		probably benign	Het
Rft1	C	T	14: 30,677,804	S315L	probably benign	Het
Rgs13	C	T	1: 144,171,479	M1I	probably null	Het
Rhbg	A	C	3: 88,247,453	S215A	probably benign	Het
Rufy2	A	T	10: 63,002,211	N379I	probably damaging	Het
Slc17a1	T	C	13: 23,880,654	L367P	probably damaging	Het
Slc25a39	G	A	11: 102,403,675	R308C	probably benign	Het
Smo	A	G	6: 29,753,571	T149A	probably benign	Het
Sqle	A	G	15: 59,316,085	K81E	probably benign	Het
Tfpi	A	G	2: 84,452,555		probably null	Het
Tnk2	A	G	16: 32,679,630	D572G	probably damaging	Het
Ubr5	A	T	15: 38,006,564	M1149K	probably benign	Het
Utrn	T	A	10: 12,727,758	Q626L	probably damaging	Het
Virma	T	A	4: 11,544,971	H1643Q	probably damaging	Het
Wnt3	G	T	11: 103,808,205	G46C	possibly damaging	Het
Zkscan7	G	T	9: 122,890,800	G184*	probably null	Het

Other mutations in Mybpc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Mybpc1	APN	10	88549262	missense	probably damaging	0.98
IGL00577:Mybpc1	APN	10	88536384	missense	probably damaging	1.00
IGL00703:Mybpc1	APN	10	88525108	splice site	probably null
IGL00964:Mybpc1	APN	10	88555742	critical splice acceptor site	probably null
IGL01738:Mybpc1	APN	10	88570645	missense	probably damaging	1.00
IGL01978:Mybpc1	APN	10	88531770	missense	probably damaging	1.00
IGL02255:Mybpc1	APN	10	88536428	missense	probably damaging	1.00
IGL02997:Mybpc1	APN	10	88526373	missense	probably damaging	1.00
R0098:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0449:Mybpc1	UTSW	10	88540960	missense	probably damaging	1.00
R0879:Mybpc1	UTSW	10	88571516	splice site	probably benign
R1321:Mybpc1	UTSW	10	88529541	missense	possibly damaging	0.85
R1321:Mybpc1	UTSW	10	88570601	missense	probably damaging	1.00
R1562:Mybpc1	UTSW	10	88553331	missense	probably damaging	1.00
R1783:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R1803:Mybpc1	UTSW	10	88553295	missense	possibly damaging	0.65
R1962:Mybpc1	UTSW	10	88548826	missense	probably damaging	1.00
R1972:Mybpc1	UTSW	10	88551542	missense	probably benign	0.00
R2006:Mybpc1	UTSW	10	88546059	missense	probably damaging	0.99
R2125:Mybpc1	UTSW	10	88573437	nonsense	probably null
R2129:Mybpc1	UTSW	10	88551452	missense	probably damaging	1.00
R2163:Mybpc1	UTSW	10	88540942	splice site	probably benign
R2200:Mybpc1	UTSW	10	88555695	missense	probably damaging	1.00
R2219:Mybpc1	UTSW	10	88555678	missense	probably damaging	1.00
R2270:Mybpc1	UTSW	10	88551407	missense	probably benign	0.01
R2961:Mybpc1	UTSW	10	88531779	missense	probably damaging	1.00
R3767:Mybpc1	UTSW	10	88570659	splice site	probably null
R4032:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R4226:Mybpc1	UTSW	10	88573525	nonsense	probably null
R4821:Mybpc1	UTSW	10	88548865	missense	probably damaging	0.98
R4876:Mybpc1	UTSW	10	88522991	missense	probably benign
R4876:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
R4910:Mybpc1	UTSW	10	88555724	nonsense	probably null
R4913:Mybpc1	UTSW	10	88553254	critical splice donor site	probably null
R4964:Mybpc1	UTSW	10	88555663	missense	probably benign	0.31
R5023:Mybpc1	UTSW	10	88543774	missense	probably damaging	1.00
R5098:Mybpc1	UTSW	10	88546064	missense	probably damaging	1.00
R5196:Mybpc1	UTSW	10	88536351	missense	probably damaging	0.97
R5344:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R5399:Mybpc1	UTSW	10	88523014	missense	probably damaging	1.00
R5538:Mybpc1	UTSW	10	88546029	missense	possibly damaging	0.89
R5808:Mybpc1	UTSW	10	88570566	missense	possibly damaging	0.83
R5970:Mybpc1	UTSW	10	88542456	missense	probably damaging	1.00
R6324:Mybpc1	UTSW	10	88568619	missense	possibly damaging	0.56
R6433:Mybpc1	UTSW	10	88560355	missense	probably damaging	1.00
R6441:Mybpc1	UTSW	10	88553277	missense	probably benign	0.09
R6648:Mybpc1	UTSW	10	88522999	missense	probably damaging	0.96
R6844:Mybpc1	UTSW	10	88536381	missense	possibly damaging	0.50
R6931:Mybpc1	UTSW	10	88542330	nonsense	probably null
R6972:Mybpc1	UTSW	10	88560361	missense	possibly damaging	0.50
R6973:Mybpc1	UTSW	10	88560361	missense	possibly damaging	0.50
R6978:Mybpc1	UTSW	10	88523024	missense	probably damaging	1.00
R7007:Mybpc1	UTSW	10	88553412	missense	probably damaging	1.00
R7019:Mybpc1	UTSW	10	88543719	missense	probably damaging	1.00
R7407:Mybpc1	UTSW	10	88549347	missense	probably damaging	0.99
R7442:Mybpc1	UTSW	10	88526293	missense	probably damaging	1.00
R7577:Mybpc1	UTSW	10	88549325	missense	probably damaging	1.00
R7660:Mybpc1	UTSW	10	88548854	missense	possibly damaging	0.51
R7768:Mybpc1	UTSW	10	88542372	missense	probably damaging	1.00
R7818:Mybpc1	UTSW	10	88558667	missense	probably damaging	1.00
R8171:Mybpc1	UTSW	10	88523003	missense	probably damaging	1.00
R8195:Mybpc1	UTSW	10	88558691	missense	possibly damaging	0.47
R8241:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
Z1176:Mybpc1	UTSW	10	88560327	missense	probably benign
Z1177:Mybpc1	UTSW	10	88573437	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGCTGATACGCCATGGTTTG -3'
(R):5'- TGTGAAATGCCACCATGGTCG -3'

Sequencing Primer
(F):5'- ACGCCATGGTTTGAGGTATAGATAC -3'
(R):5'- CACCATGGTCGCTTGTCTGG -3'

Posted On

2016-03-17