Incidental Mutation 'R4878:Mybpc1'
ID 375071
Institutional Source Beutler Lab
Gene Symbol Mybpc1
Ensembl Gene ENSMUSG00000020061
Gene Name myosin binding protein C, slow-type
Synonyms 8030451F13Rik, Slow-type C-protein
MMRRC Submission 042487-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.829) question?
Stock # R4878 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 88518279-88605152 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88551430 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 473 (Q473R)
Ref Sequence ENSEMBL: ENSMUSP00000112615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]
AlphaFold A0A571BEN1
Predicted Effect probably benign
Transcript: ENSMUST00000119185
AA Change: Q459R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: Q459R

DomainStartEndE-ValueType
IG 51 147 1.96e-6 SMART
low complexity region 221 233 N/A INTRINSIC
IG 246 325 4.53e-2 SMART
IG 335 416 1.13e-2 SMART
IG 426 506 6.97e-3 SMART
IG 519 604 2.83e-3 SMART
FN3 607 690 4.28e-10 SMART
FN3 705 788 1.49e-9 SMART
low complexity region 800 812 N/A INTRINSIC
IG 815 898 9.06e-2 SMART
FN3 901 983 2.06e-12 SMART
IGc2 1028 1095 1.88e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121629
AA Change: Q473R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: Q473R

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
IG 65 161 1.96e-6 SMART
low complexity region 235 247 N/A INTRINSIC
IG 260 339 4.53e-2 SMART
IG 349 430 1.13e-2 SMART
IG 440 520 6.97e-3 SMART
IG 533 618 2.83e-3 SMART
FN3 621 704 4.28e-10 SMART
FN3 719 802 1.49e-9 SMART
low complexity region 814 826 N/A INTRINSIC
IG 829 912 9.06e-2 SMART
FN3 915 997 2.06e-12 SMART
IGc2 1042 1109 1.88e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156573
AA Change: Q98R
SMART Domains Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061
AA Change: Q98R

DomainStartEndE-ValueType
PDB:1X44|A 2 58 1e-26 PDB
IG 66 146 6.97e-3 SMART
IG 159 244 2.83e-3 SMART
FN3 247 330 4.28e-10 SMART
FN3 345 446 1.6e-9 SMART
low complexity region 458 470 N/A INTRINSIC
IG 473 556 9.06e-2 SMART
FN3 559 617 8.17e0 SMART
Meta Mutation Damage Score 0.0856 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Mybpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mybpc1 APN 10 88549262 missense probably damaging 0.98
IGL00577:Mybpc1 APN 10 88536384 missense probably damaging 1.00
IGL00703:Mybpc1 APN 10 88525108 splice site probably null
IGL00964:Mybpc1 APN 10 88555742 critical splice acceptor site probably null
IGL01738:Mybpc1 APN 10 88570645 missense probably damaging 1.00
IGL01978:Mybpc1 APN 10 88531770 missense probably damaging 1.00
IGL02255:Mybpc1 APN 10 88536428 missense probably damaging 1.00
IGL02997:Mybpc1 APN 10 88526373 missense probably damaging 1.00
R0098:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0449:Mybpc1 UTSW 10 88540960 missense probably damaging 1.00
R0879:Mybpc1 UTSW 10 88571516 splice site probably benign
R1321:Mybpc1 UTSW 10 88529541 missense possibly damaging 0.85
R1321:Mybpc1 UTSW 10 88570601 missense probably damaging 1.00
R1562:Mybpc1 UTSW 10 88553331 missense probably damaging 1.00
R1783:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R1803:Mybpc1 UTSW 10 88553295 missense possibly damaging 0.65
R1962:Mybpc1 UTSW 10 88548826 missense probably damaging 1.00
R1972:Mybpc1 UTSW 10 88551542 missense probably benign 0.00
R2006:Mybpc1 UTSW 10 88546059 missense probably damaging 0.99
R2125:Mybpc1 UTSW 10 88573437 nonsense probably null
R2129:Mybpc1 UTSW 10 88551452 missense probably damaging 1.00
R2163:Mybpc1 UTSW 10 88540942 splice site probably benign
R2200:Mybpc1 UTSW 10 88555695 missense probably damaging 1.00
R2219:Mybpc1 UTSW 10 88555678 missense probably damaging 1.00
R2270:Mybpc1 UTSW 10 88551407 missense probably benign 0.01
R2961:Mybpc1 UTSW 10 88531779 missense probably damaging 1.00
R3767:Mybpc1 UTSW 10 88570659 splice site probably null
R4032:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R4226:Mybpc1 UTSW 10 88573525 nonsense probably null
R4821:Mybpc1 UTSW 10 88548865 missense probably damaging 0.98
R4876:Mybpc1 UTSW 10 88522991 missense probably benign
R4876:Mybpc1 UTSW 10 88536424 missense probably benign 0.03
R4910:Mybpc1 UTSW 10 88555724 nonsense probably null
R4913:Mybpc1 UTSW 10 88553254 critical splice donor site probably null
R4964:Mybpc1 UTSW 10 88555663 missense probably benign 0.31
R5023:Mybpc1 UTSW 10 88543774 missense probably damaging 1.00
R5098:Mybpc1 UTSW 10 88546064 missense probably damaging 1.00
R5196:Mybpc1 UTSW 10 88536351 missense probably damaging 0.97
R5344:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R5399:Mybpc1 UTSW 10 88523014 missense probably damaging 1.00
R5538:Mybpc1 UTSW 10 88546029 missense possibly damaging 0.89
R5808:Mybpc1 UTSW 10 88570566 missense possibly damaging 0.83
R5970:Mybpc1 UTSW 10 88542456 missense probably damaging 1.00
R6324:Mybpc1 UTSW 10 88568619 missense possibly damaging 0.56
R6433:Mybpc1 UTSW 10 88560355 missense probably damaging 1.00
R6441:Mybpc1 UTSW 10 88553277 missense probably benign 0.09
R6648:Mybpc1 UTSW 10 88522999 missense probably damaging 0.96
R6844:Mybpc1 UTSW 10 88536381 missense possibly damaging 0.50
R6931:Mybpc1 UTSW 10 88542330 nonsense probably null
R6972:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6973:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6978:Mybpc1 UTSW 10 88523024 missense probably damaging 1.00
R7007:Mybpc1 UTSW 10 88553412 missense probably damaging 1.00
R7019:Mybpc1 UTSW 10 88543719 missense probably damaging 1.00
R7407:Mybpc1 UTSW 10 88549347 missense probably damaging 0.99
R7442:Mybpc1 UTSW 10 88526293 missense probably damaging 1.00
R7577:Mybpc1 UTSW 10 88549325 missense probably damaging 1.00
R7660:Mybpc1 UTSW 10 88548854 missense possibly damaging 0.51
R7768:Mybpc1 UTSW 10 88542372 missense probably damaging 1.00
R7818:Mybpc1 UTSW 10 88558667 missense probably damaging 1.00
R8171:Mybpc1 UTSW 10 88523003 missense probably damaging 1.00
R8195:Mybpc1 UTSW 10 88558691 missense possibly damaging 0.47
R8241:Mybpc1 UTSW 10 88536424 missense probably benign 0.03
R8360:Mybpc1 UTSW 10 88573497 nonsense probably null
R8494:Mybpc1 UTSW 10 88526429 missense probably benign 0.01
R8849:Mybpc1 UTSW 10 88571585 missense probably benign 0.01
R8936:Mybpc1 UTSW 10 88558575 missense probably benign 0.44
R9031:Mybpc1 UTSW 10 88523044 missense probably damaging 0.99
R9061:Mybpc1 UTSW 10 88555639 missense probably damaging 1.00
R9081:Mybpc1 UTSW 10 88553306 missense probably damaging 1.00
R9172:Mybpc1 UTSW 10 88543753 missense possibly damaging 0.93
R9323:Mybpc1 UTSW 10 88524967 critical splice donor site probably null
R9460:Mybpc1 UTSW 10 88536335 missense probably damaging 0.99
R9488:Mybpc1 UTSW 10 88543762 missense possibly damaging 0.47
R9757:Mybpc1 UTSW 10 88536395 missense probably damaging 1.00
R9796:Mybpc1 UTSW 10 88570635 missense possibly damaging 0.56
Z1176:Mybpc1 UTSW 10 88560327 missense probably benign
Z1177:Mybpc1 UTSW 10 88573437 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTGATACGCCATGGTTTG -3'
(R):5'- TGTGAAATGCCACCATGGTCG -3'

Sequencing Primer
(F):5'- ACGCCATGGTTTGAGGTATAGATAC -3'
(R):5'- CACCATGGTCGCTTGTCTGG -3'
Posted On 2016-03-17