Incidental Mutation 'R4878:Olfr412'
ID375074
Institutional Source Beutler Lab
Gene Symbol Olfr412
Ensembl Gene ENSMUSG00000058275
Gene Nameolfactory receptor 412
SynonymsMOR127-5P, GA_x6K02T2P1NL-4500587-4501525
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74362069-74366218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74364848 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 60 (Y60H)
Ref Sequence ENSEMBL: ENSMUSP00000149922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077794] [ENSMUST00000216362]
Predicted Effect probably damaging
Transcript: ENSMUST00000077794
AA Change: Y60H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076967
Gene: ENSMUSG00000058275
AA Change: Y60H

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 172 1.8e-8 PFAM
Pfam:7tm_1 41 289 3.8e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216362
AA Change: Y60H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2355 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Olfr412
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Olfr412 APN 11 74364912 missense possibly damaging 0.82
IGL01395:Olfr412 APN 11 74364887 missense probably damaging 1.00
IGL01418:Olfr412 APN 11 74364984 missense possibly damaging 0.85
IGL01645:Olfr412 APN 11 74365533 missense possibly damaging 0.95
IGL02421:Olfr412 APN 11 74365191 missense probably damaging 1.00
IGL02424:Olfr412 APN 11 74365473 missense probably benign 0.09
R0206:Olfr412 UTSW 11 74365142 missense probably benign 0.00
R0206:Olfr412 UTSW 11 74365142 missense probably benign 0.00
R0278:Olfr412 UTSW 11 74365202 missense probably damaging 1.00
R0698:Olfr412 UTSW 11 74365142 missense probably benign 0.00
R1424:Olfr412 UTSW 11 74364954 missense probably benign 0.05
R1549:Olfr412 UTSW 11 74365250 missense probably benign 0.00
R1659:Olfr412 UTSW 11 74364933 missense probably benign 0.01
R1755:Olfr412 UTSW 11 74364993 missense probably damaging 1.00
R2031:Olfr412 UTSW 11 74364951 missense probably damaging 1.00
R2185:Olfr412 UTSW 11 74364746 missense probably benign
R3620:Olfr412 UTSW 11 74365224 missense probably damaging 1.00
R4568:Olfr412 UTSW 11 74365209 missense probably damaging 0.99
R7779:Olfr412 UTSW 11 74364945 missense probably damaging 1.00
R8086:Olfr412 UTSW 11 74364954 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCTCACATTGCAGACAACTG -3'
(R):5'- TGGCCACATAACGGTCATATG -3'

Sequencing Primer
(F):5'- CTCACATTGCAGACAACTGGGAAATG -3'
(R):5'- GTCATATGCCATTACAGCCAGGATG -3'
Posted On2016-03-17