Incidental Mutation 'R4878:Gga3'
ID375078
Institutional Source Beutler Lab
Gene Symbol Gga3
Ensembl Gene ENSMUSG00000020740
Gene Namegolgi associated, gamma adaptin ear containing, ARF binding protein 3
Synonyms
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R4878 (G1)
Quality Score160
Status Validated
Chromosome11
Chromosomal Location115584255-115604051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115591321 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 157 (I157N)
Ref Sequence ENSEMBL: ENSMUSP00000019135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019135] [ENSMUST00000106508] [ENSMUST00000125097] [ENSMUST00000156173]
Predicted Effect probably damaging
Transcript: ENSMUST00000019135
AA Change: I157N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019135
Gene: ENSMUSG00000020740
AA Change: I157N

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 222 299 1.7e-20 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Alpha_adaptinC2 586 710 6.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106508
AA Change: I157N

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102117
Gene: ENSMUSG00000020740
AA Change: I157N

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 1.3e-32 PFAM
low complexity region 377 393 N/A INTRINSIC
low complexity region 405 420 N/A INTRINSIC
low complexity region 454 476 N/A INTRINSIC
Alpha_adaptinC2 508 632 6.09e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123831
Predicted Effect probably benign
Transcript: ENSMUST00000125097
SMART Domains Protein: ENSMUSP00000118024
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
Pfam:VHS 3 106 3.4e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154832
Predicted Effect probably benign
Transcript: ENSMUST00000156173
AA Change: I157N

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138597
Gene: ENSMUSG00000020740
AA Change: I157N

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 7.3e-32 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Meta Mutation Damage Score 0.0643 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) family. This family includes ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. Multiple alternatively spliced transcript variants have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene-trapped allele display decreased birth weight, slow postnatal weight gain, hypoglycemia, increased plasma levels of acid hydrolases, and partial neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Gga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Gga3 APN 11 115591741 missense probably damaging 1.00
IGL01449:Gga3 APN 11 115589102 missense probably damaging 1.00
IGL03343:Gga3 APN 11 115592486 missense probably damaging 0.99
IGL03390:Gga3 APN 11 115586994 critical splice donor site probably null
R0049:Gga3 UTSW 11 115587089 nonsense probably null
R0133:Gga3 UTSW 11 115588979 splice site probably benign
R0411:Gga3 UTSW 11 115587433 missense probably damaging 1.00
R0432:Gga3 UTSW 11 115590524 missense probably damaging 1.00
R0865:Gga3 UTSW 11 115592459 missense probably damaging 1.00
R3852:Gga3 UTSW 11 115587542 missense probably benign 0.04
R4869:Gga3 UTSW 11 115586285 intron probably benign
R5380:Gga3 UTSW 11 115588431 missense probably damaging 1.00
R5527:Gga3 UTSW 11 115587436 missense probably damaging 0.98
R6545:Gga3 UTSW 11 115587169 missense possibly damaging 0.71
R6805:Gga3 UTSW 11 115585762 missense probably damaging 1.00
R6967:Gga3 UTSW 11 115591276 missense probably damaging 1.00
R8311:Gga3 UTSW 11 115587008 missense probably benign 0.19
Z1176:Gga3 UTSW 11 115587603 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAGGGGATGGCATGTACC -3'
(R):5'- AAGTTGTCATGAGGGCTCGAC -3'

Sequencing Primer
(F):5'- AAGACCCCACTTCATGCTTGCTAG -3'
(R):5'- GGCTCGACTGGGCTTCTAG -3'
Posted On2016-03-17