Mutagenetix > Incidental Mutation

Incidental Mutation 'R4878:Ncoa1'

375079

Institutional Source

Beutler Lab

Gene Symbol

Ncoa1

Ensembl Gene

ENSMUSG00000020647

Gene Name

nuclear receptor coactivator 1

Synonyms

bHLHe74, SRC-a/NCoA-1, KAT13A, SRC-1, SRC1, steroid receptor coactivator-1

MMRRC Submission

042487-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4878 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4247362-4477182 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 4275004 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 970 (G970D)

Ref Sequence

ENSEMBL: ENSMUSP00000151358 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085814] [ENSMUST00000217674] [ENSMUST00000217794] [ENSMUST00000220434]

AlphaFold

P70365

Predicted Effect

probably damaging
Transcript: ENSMUST00000085814
AA Change: G970D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082971
Gene: ENSMUSG00000020647
AA Change: G970D

Domain	Start	End	E-Value	Type
HLH	29	86	1.73e-9	SMART
PAS	111	178	1.32e-10	SMART
Pfam:PAS_11	259	370	8e-37	PFAM
low complexity region	419	441	N/A	INTRINSIC
Pfam:NCOA_u2	468	591	1.3e-29	PFAM
Pfam:SRC-1	632	712	3.5e-26	PFAM
low complexity region	724	736	N/A	INTRINSIC
PDB:3RVF\|B	747	767	1e-6	PDB
low complexity region	777	785	N/A	INTRINSIC
low complexity region	869	880	N/A	INTRINSIC
Pfam:Nuc_rec_co-act	930	977	2.3e-23	PFAM
low complexity region	1059	1080	N/A	INTRINSIC
low complexity region	1125	1137	N/A	INTRINSIC
DUF1518	1155	1211	7.47e-16	SMART
DUF1518	1218	1274	1.14e-11	SMART
low complexity region	1303	1315	N/A	INTRINSIC
low complexity region	1333	1354	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000217674
AA Change: G859D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000217794
AA Change: G970D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000218191

Predicted Effect

probably damaging
Transcript: ENSMUST00000220434
AA Change: G970D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.5529

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a transcriptional coactivator for steroid and nuclear hormone receptors. It is a member of the p160/steroid receptor coactivator (SRC) family and like other family members has histone acetyltransferase activity and contains a nuclear localization signal, as well as bHLH and PAS domains. The product of this gene binds nuclear receptors directly and stimulates the transcriptional activities in a hormone-dependent fashion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show osteopenia, increased serum sex hormone levels, altered bone remodeling and skeletal responses to sex hormones, and obesity. Homozygotes for another null allele show thyroid and steroid hormone resistance, delayed Purkinje cell development, and behavioral deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	C	A	4: 144,613,845	H47N	possibly damaging	Het
Adgrg3	A	T	8: 95,035,086	N159I	possibly damaging	Het
Agrn	A	T	4: 156,170,845	L1449Q	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Atg2a	A	T	19: 6,250,244	E694V	probably damaging	Het
Ccndbp1	T	A	2: 121,014,691	L363*	probably null	Het
Cdh16	A	T	8: 104,618,064	D478E	probably damaging	Het
Cep295	A	T	9: 15,334,956	W735R	probably benign	Het
Cnnm2	C	T	19: 46,859,083	P682S	probably benign	Het
Daam2	C	A	17: 49,460,710	R951L	probably damaging	Het
Dmxl1	T	A	18: 49,851,476	F180I	probably damaging	Het
Dnajc6	T	C	4: 101,599,034		probably benign	Het
Efemp2	A	T	19: 5,480,761		probably benign	Het
Emilin1	A	G	5: 30,917,066	D217G	probably benign	Het
Enpep	A	T	3: 129,276,771	M829K	probably benign	Het
Epb41l4a	A	G	18: 33,798,572	V623A	probably damaging	Het
Erlin2	T	A	8: 27,027,166		probably null	Het
Fbln2	T	C	6: 91,256,995		probably null	Het
Gga3	A	T	11: 115,591,321	I157N	probably damaging	Het
Gm884	A	G	11: 103,617,891		probably benign	Het
Gtpbp6	C	T	5: 110,107,311		probably benign	Het
Hps4	T	C	5: 112,375,368	V584A	probably benign	Het
Ighv1-50	T	C	12: 115,119,947	Y51C	probably benign	Het
Kif13b	T	C	14: 64,806,154	L1801P	probably benign	Het
Kif16b	T	C	2: 142,848,003	I330V	probably damaging	Het
Klb	A	T	5: 65,348,490	R27W	probably damaging	Het
Lrif1	A	T	3: 106,735,640	K169M	probably damaging	Het
Met	A	G	6: 17,549,059	D970G	probably damaging	Het
Mical3	A	T	6: 120,969,387	M1051K	possibly damaging	Het
Mios	A	G	6: 8,215,094	N97D	probably benign	Het
Msh5	G	A	17: 35,038,456	R321C	probably damaging	Het
Mybpc1	T	C	10: 88,551,430	Q473R	possibly damaging	Het
Neb	T	C	2: 52,219,394	Y232C	probably damaging	Het
Nefh	A	G	11: 4,941,333	S429P	probably damaging	Het
Notch3	C	T	17: 32,147,085	G1014D	probably damaging	Het
Nup107	A	T	10: 117,751,418	C859S	probably benign	Het
Olfr1033	A	G	2: 86,041,455	I47V	probably benign	Het
Olfr136	T	G	17: 38,335,627	F157V	probably benign	Het
Olfr412	T	C	11: 74,364,848	Y60H	probably damaging	Het
Otud7b	T	A	3: 96,136,510		probably benign	Het
Pde1a	A	T	2: 79,878,139	S312T	probably benign	Het
Piwil1	G	T	5: 128,740,981	R94L	probably damaging	Het
Pnma2	G	A	14: 66,917,054	W309*	probably null	Het
Ppef2	A	C	5: 92,228,740		probably null	Het
Rabac1	T	A	7: 24,969,967	Q212L	possibly damaging	Het
Rad51	T	C	2: 119,120,492		probably benign	Het
Rbm48	A	T	5: 3,591,853		probably benign	Het
Rft1	C	T	14: 30,677,804	S315L	probably benign	Het
Rgs13	C	T	1: 144,171,479	M1I	probably null	Het
Rhbg	A	C	3: 88,247,453	S215A	probably benign	Het
Rufy2	A	T	10: 63,002,211	N379I	probably damaging	Het
Slc17a1	T	C	13: 23,880,654	L367P	probably damaging	Het
Slc25a39	G	A	11: 102,403,675	R308C	probably benign	Het
Smo	A	G	6: 29,753,571	T149A	probably benign	Het
Sqle	A	G	15: 59,316,085	K81E	probably benign	Het
Tfpi	A	G	2: 84,452,555		probably null	Het
Tnk2	A	G	16: 32,679,630	D572G	probably damaging	Het
Ubr5	A	T	15: 38,006,564	M1149K	probably benign	Het
Utrn	T	A	10: 12,727,758	Q626L	probably damaging	Het
Virma	T	A	4: 11,544,971	H1643Q	probably damaging	Het
Wnt3	G	T	11: 103,808,205	G46C	possibly damaging	Het
Zkscan7	G	T	9: 122,890,800	G184*	probably null	Het

Other mutations in Ncoa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00598:Ncoa1	APN	12	4278218	missense	probably benign
IGL01335:Ncoa1	APN	12	4297520	missense	probably benign	0.31
IGL02111:Ncoa1	APN	12	4274944	start codon destroyed	probably null
IGL02863:Ncoa1	APN	12	4297513	missense	probably benign	0.00
IGL02967:Ncoa1	APN	12	4295294	missense	probably damaging	1.00
IGL03007:Ncoa1	APN	12	4339114	missense	possibly damaging	0.92
IGL03031:Ncoa1	APN	12	4274818	missense	possibly damaging	0.76
IGL03048:Ncoa1	UTSW	12	4267922	missense	probably damaging	0.96
IGL03147:Ncoa1	UTSW	12	4259342	missense	probably damaging	1.00
PIT1430001:Ncoa1	UTSW	12	4323005	missense	probably benign	0.19
PIT4402001:Ncoa1	UTSW	12	4294987	missense	probably benign	0.00
R0002:Ncoa1	UTSW	12	4290885	missense	probably benign	0.00
R0011:Ncoa1	UTSW	12	4322896	missense	possibly damaging	0.94
R0389:Ncoa1	UTSW	12	4295976	missense	probably benign	0.05
R0467:Ncoa1	UTSW	12	4267687	missense	possibly damaging	0.49
R0480:Ncoa1	UTSW	12	4339105	missense	probably damaging	1.00
R0541:Ncoa1	UTSW	12	4323033	missense	probably damaging	1.00
R0671:Ncoa1	UTSW	12	4249758	splice site	probably null
R1387:Ncoa1	UTSW	12	4274790	missense	probably benign	0.01
R1426:Ncoa1	UTSW	12	4270737	splice site	probably benign
R1538:Ncoa1	UTSW	12	4270748	missense	possibly damaging	0.94
R1577:Ncoa1	UTSW	12	4295196	missense	probably damaging	0.99
R1902:Ncoa1	UTSW	12	4339049	missense	possibly damaging	0.78
R1905:Ncoa1	UTSW	12	4295433	missense	probably damaging	1.00
R2026:Ncoa1	UTSW	12	4267647	missense	probably benign	0.19
R2259:Ncoa1	UTSW	12	4315819	missense	probably damaging	1.00
R2317:Ncoa1	UTSW	12	4275189	missense	probably damaging	0.99
R3608:Ncoa1	UTSW	12	4278186	missense	probably benign	0.00
R4042:Ncoa1	UTSW	12	4267871	missense	probably damaging	0.99
R4688:Ncoa1	UTSW	12	4315781	missense	probably benign	0.26
R4763:Ncoa1	UTSW	12	4275297	missense	probably damaging	1.00
R5062:Ncoa1	UTSW	12	4259333	missense	probably damaging	0.99
R5531:Ncoa1	UTSW	12	4253746	missense	probably benign
R6393:Ncoa1	UTSW	12	4278181	missense	probably benign	0.00
R6711:Ncoa1	UTSW	12	4322904	missense	probably benign	0.26
R7066:Ncoa1	UTSW	12	4322934	missense	possibly damaging	0.90
R7109:Ncoa1	UTSW	12	4322978	missense	possibly damaging	0.63
R7170:Ncoa1	UTSW	12	4249722	missense	probably benign	0.32
R7395:Ncoa1	UTSW	12	4295188	missense	not run
R7453:Ncoa1	UTSW	12	4259307	missense	probably damaging	1.00
R7556:Ncoa1	UTSW	12	4270794	missense	probably damaging	0.98
R7821:Ncoa1	UTSW	12	4296221	missense	probably benign	0.00
R7872:Ncoa1	UTSW	12	4278186	missense	probably benign	0.00
R7885:Ncoa1	UTSW	12	4339044	missense	probably damaging	1.00
R7936:Ncoa1	UTSW	12	4335873	missense	possibly damaging	0.53
R7940:Ncoa1	UTSW	12	4313095	missense	possibly damaging	0.50
R8126:Ncoa1	UTSW	12	4290951	missense	probably damaging	1.00
R8176:Ncoa1	UTSW	12	4267858	missense	possibly damaging	0.90
R8492:Ncoa1	UTSW	12	4263473	missense	probably damaging	1.00
R8510:Ncoa1	UTSW	12	4259303	missense	probably benign
R8772:Ncoa1	UTSW	12	4322940	missense	possibly damaging	0.63
R9082:Ncoa1	UTSW	12	4296106	missense	probably benign	0.02
R9094:Ncoa1	UTSW	12	4295494	missense	possibly damaging	0.86
R9238:Ncoa1	UTSW	12	4275177	missense	possibly damaging	0.95
R9434:Ncoa1	UTSW	12	4315755	missense	probably benign
R9491:Ncoa1	UTSW	12	4290912	missense	probably benign	0.20
R9542:Ncoa1	UTSW	12	4275178	missense	possibly damaging	0.57
R9625:Ncoa1	UTSW	12	4295643	missense	probably damaging	1.00
Z1177:Ncoa1	UTSW	12	4306514	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTCTATTGAGAGTCTGCCG -3'
(R):5'- GTGCTTGTTCAGACATGGCG -3'

Sequencing Primer
(F):5'- GTGTTACTTGAACCGGCATAGCC -3'
(R):5'- CTTGTTCAGACATGGCGATGAGC -3'

Posted On

2016-03-17