Mutagenetix > Incidental Mutations

Incidental Mutation 'R4878:Kif13b'

375084

Institutional Source

Beutler Lab

Gene Symbol

Kif13b

Ensembl Gene

ENSMUSG00000060012

Gene Name

kinesin family member 13B

Synonyms

N-3 kinesin, C130021D12Rik, 5330429L19Rik, GAKIN

MMRRC Submission

042487-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4878 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64647265-64809617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64806154 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1801 (L1801P)

Ref Sequence

ENSEMBL: ENSMUSP00000153168 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100473] [ENSMUST00000224503]

AlphaFold

A0A286YCV9

Predicted Effect

probably benign
Transcript: ENSMUST00000100473
AA Change: L1797P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000098041
Gene: ENSMUSG00000060012
AA Change: L1797P

Domain	Start	End	E-Value	Type
KISc	3	361	1.4e-182	SMART
FHA	470	520	6.86e-1	SMART
low complexity region	546	560	N/A	INTRINSIC
coiled coil region	617	646	N/A	INTRINSIC
coiled coil region	669	701	N/A	INTRINSIC
Pfam:KIF1B	756	802	4.1e-20	PFAM
Pfam:DUF3694	1003	1279	1.4e-37	PFAM
low complexity region	1514	1526	N/A	INTRINSIC
low complexity region	1532	1548	N/A	INTRINSIC
low complexity region	1574	1589	N/A	INTRINSIC
low complexity region	1617	1630	N/A	INTRINSIC
CAP_GLY	1719	1784	1.54e-29	SMART
low complexity region	1814	1826	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224503
AA Change: L1801P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224677

Meta Mutation Damage Score

0.0700

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

96% (70/73)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating cholesterol and factor VIII levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	C	A	4: 144,613,845	H47N	possibly damaging	Het
Adgrg3	A	T	8: 95,035,086	N159I	possibly damaging	Het
Agrn	A	T	4: 156,170,845	L1449Q	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Atg2a	A	T	19: 6,250,244	E694V	probably damaging	Het
Ccndbp1	T	A	2: 121,014,691	L363*	probably null	Het
Cdh16	A	T	8: 104,618,064	D478E	probably damaging	Het
Cep295	A	T	9: 15,334,956	W735R	probably benign	Het
Cnnm2	C	T	19: 46,859,083	P682S	probably benign	Het
Daam2	C	A	17: 49,460,710	R951L	probably damaging	Het
Dmxl1	T	A	18: 49,851,476	F180I	probably damaging	Het
Dnajc6	T	C	4: 101,599,034		probably benign	Het
Efemp2	A	T	19: 5,480,761		probably benign	Het
Emilin1	A	G	5: 30,917,066	D217G	probably benign	Het
Enpep	A	T	3: 129,276,771	M829K	probably benign	Het
Epb41l4a	A	G	18: 33,798,572	V623A	probably damaging	Het
Erlin2	T	A	8: 27,027,166		probably null	Het
Fbln2	T	C	6: 91,256,995		probably null	Het
Gga3	A	T	11: 115,591,321	I157N	probably damaging	Het
Gm884	A	G	11: 103,617,891		probably benign	Het
Gtpbp6	C	T	5: 110,107,311		probably benign	Het
Hps4	T	C	5: 112,375,368	V584A	probably benign	Het
Ighv1-50	T	C	12: 115,119,947	Y51C	probably benign	Het
Kif16b	T	C	2: 142,848,003	I330V	probably damaging	Het
Klb	A	T	5: 65,348,490	R27W	probably damaging	Het
Lrif1	A	T	3: 106,735,640	K169M	probably damaging	Het
Met	A	G	6: 17,549,059	D970G	probably damaging	Het
Mical3	A	T	6: 120,969,387	M1051K	possibly damaging	Het
Mios	A	G	6: 8,215,094	N97D	probably benign	Het
Msh5	G	A	17: 35,038,456	R321C	probably damaging	Het
Mybpc1	T	C	10: 88,551,430	Q473R	possibly damaging	Het
Ncoa1	C	T	12: 4,275,004	G970D	probably damaging	Het
Neb	T	C	2: 52,219,394	Y232C	probably damaging	Het
Nefh	A	G	11: 4,941,333	S429P	probably damaging	Het
Notch3	C	T	17: 32,147,085	G1014D	probably damaging	Het
Nup107	A	T	10: 117,751,418	C859S	probably benign	Het
Olfr1033	A	G	2: 86,041,455	I47V	probably benign	Het
Olfr136	T	G	17: 38,335,627	F157V	probably benign	Het
Olfr412	T	C	11: 74,364,848	Y60H	probably damaging	Het
Otud7b	T	A	3: 96,136,510		probably benign	Het
Pde1a	A	T	2: 79,878,139	S312T	probably benign	Het
Piwil1	G	T	5: 128,740,981	R94L	probably damaging	Het
Pnma2	G	A	14: 66,917,054	W309*	probably null	Het
Ppef2	A	C	5: 92,228,740		probably null	Het
Rabac1	T	A	7: 24,969,967	Q212L	possibly damaging	Het
Rad51	T	C	2: 119,120,492		probably benign	Het
Rbm48	A	T	5: 3,591,853		probably benign	Het
Rft1	C	T	14: 30,677,804	S315L	probably benign	Het
Rgs13	C	T	1: 144,171,479	M1I	probably null	Het
Rhbg	A	C	3: 88,247,453	S215A	probably benign	Het
Rufy2	A	T	10: 63,002,211	N379I	probably damaging	Het
Slc17a1	T	C	13: 23,880,654	L367P	probably damaging	Het
Slc25a39	G	A	11: 102,403,675	R308C	probably benign	Het
Smo	A	G	6: 29,753,571	T149A	probably benign	Het
Sqle	A	G	15: 59,316,085	K81E	probably benign	Het
Tfpi	A	G	2: 84,452,555		probably null	Het
Tnk2	A	G	16: 32,679,630	D572G	probably damaging	Het
Ubr5	A	T	15: 38,006,564	M1149K	probably benign	Het
Utrn	T	A	10: 12,727,758	Q626L	probably damaging	Het
Virma	T	A	4: 11,544,971	H1643Q	probably damaging	Het
Wnt3	G	T	11: 103,808,205	G46C	possibly damaging	Het
Zkscan7	G	T	9: 122,890,800	G184*	probably null	Het

Other mutations in Kif13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Kif13b	APN	14	64669693	missense	possibly damaging	0.81
IGL00485:Kif13b	APN	14	64765073	missense	possibly damaging	0.88
IGL00495:Kif13b	APN	14	64714113	missense	probably benign	0.07
IGL00556:Kif13b	APN	14	64744888	missense	probably damaging	1.00
IGL00571:Kif13b	APN	14	64746417	missense	probably damaging	0.99
IGL00590:Kif13b	APN	14	64779462	missense	probably damaging	1.00
IGL01650:Kif13b	APN	14	64765145	missense	probably benign	0.00
IGL01730:Kif13b	APN	14	64750361	critical splice donor site	probably null
IGL01908:Kif13b	APN	14	64757558	missense	probably damaging	1.00
IGL02388:Kif13b	APN	14	64800358	missense	probably damaging	1.00
IGL02573:Kif13b	APN	14	64803431	missense	probably damaging	1.00
IGL02661:Kif13b	APN	14	64767691	missense	probably benign	0.06
IGL02794:Kif13b	APN	14	64803440	missense	probably benign	0.00
IGL02959:Kif13b	APN	14	64767717	missense	probably damaging	1.00
IGL02979:Kif13b	APN	14	64789697	missense	probably damaging	0.96
IGL03114:Kif13b	APN	14	64788448	missense	probably benign	0.00
R0024:Kif13b	UTSW	14	64750273	missense	probably benign	0.30
R0330:Kif13b	UTSW	14	64803220	missense	probably benign
R0376:Kif13b	UTSW	14	64757404	splice site	probably benign
R0571:Kif13b	UTSW	14	64751528	missense	probably damaging	1.00
R0718:Kif13b	UTSW	14	64751662	splice site	probably benign
R1144:Kif13b	UTSW	14	64714117	missense	probably benign	0.01
R1183:Kif13b	UTSW	14	64782377	missense	probably benign	0.00
R1264:Kif13b	UTSW	14	64776232	splice site	probably benign
R1497:Kif13b	UTSW	14	64736266	missense	probably damaging	0.99
R1579:Kif13b	UTSW	14	64782341	critical splice acceptor site	probably null
R1624:Kif13b	UTSW	14	64738619	missense	probably damaging	0.99
R1706:Kif13b	UTSW	14	64760666	splice site	probably benign
R2176:Kif13b	UTSW	14	64669671	missense	probably benign	0.01
R3727:Kif13b	UTSW	14	64765748	splice site	probably benign
R3785:Kif13b	UTSW	14	64800400	missense	probably benign	0.00
R3786:Kif13b	UTSW	14	64800400	missense	probably benign	0.00
R4088:Kif13b	UTSW	14	64767455	critical splice donor site	probably null
R4279:Kif13b	UTSW	14	64779356	missense	probably damaging	1.00
R4559:Kif13b	UTSW	14	64806132	missense	probably damaging	0.98
R4689:Kif13b	UTSW	14	64773064	missense	probably damaging	1.00
R4692:Kif13b	UTSW	14	64803575	missense	probably benign	0.05
R4971:Kif13b	UTSW	14	64757562	missense	possibly damaging	0.90
R5037:Kif13b	UTSW	14	64758589	nonsense	probably null
R5119:Kif13b	UTSW	14	64757453	missense	probably benign	0.01
R5167:Kif13b	UTSW	14	64772935	missense	probably damaging	1.00
R5408:Kif13b	UTSW	14	64779689	critical splice acceptor site	probably null
R5437:Kif13b	UTSW	14	64806114	missense	probably damaging	0.99
R5756:Kif13b	UTSW	14	64736305	missense	probably damaging	1.00
R5838:Kif13b	UTSW	14	64737555	missense	probably damaging	1.00
R5891:Kif13b	UTSW	14	64788405	splice site	probably null
R6120:Kif13b	UTSW	14	64751558	missense	probably damaging	1.00
R6150:Kif13b	UTSW	14	64751639	missense	probably damaging	0.99
R6165:Kif13b	UTSW	14	64742311	missense	probably damaging	1.00
R6187:Kif13b	UTSW	14	64736215	missense	probably damaging	1.00
R6229:Kif13b	UTSW	14	64738567	missense	probably damaging	1.00
R6267:Kif13b	UTSW	14	64738634	missense	probably damaging	1.00
R6347:Kif13b	UTSW	14	64767619	missense	probably benign	0.26
R6479:Kif13b	UTSW	14	64751525	missense	probably benign	0.08
R6512:Kif13b	UTSW	14	64744874	critical splice acceptor site	probably null
R6851:Kif13b	UTSW	14	64773065	missense	probably damaging	1.00
R7131:Kif13b	UTSW	14	64773068	missense	probably damaging	1.00
R7217:Kif13b	UTSW	14	64773068	missense	probably damaging	1.00
R7398:Kif13b	UTSW	14	64757523	missense	probably null	0.02
R7427:Kif13b	UTSW	14	64788460	missense	probably benign
R7428:Kif13b	UTSW	14	64788460	missense	probably benign
R7573:Kif13b	UTSW	14	64803658	missense	probably benign	0.00
R7629:Kif13b	UTSW	14	64779335	nonsense	probably null
R7683:Kif13b	UTSW	14	64757507	missense	probably benign	0.24
R7835:Kif13b	UTSW	14	64767452	missense	probably benign	0.00
R7895:Kif13b	UTSW	14	64736149	missense	probably damaging	1.00
R8285:Kif13b	UTSW	14	64782376	missense	probably benign	0.03
R8374:Kif13b	UTSW	14	64788435	missense	probably damaging	0.97
R8467:Kif13b	UTSW	14	64758705	missense	probably damaging	0.96
R8804:Kif13b	UTSW	14	64750342	missense	probably damaging	0.99
R8859:Kif13b	UTSW	14	64742433	missense	probably benign	0.04
R8891:Kif13b	UTSW	14	64744877	missense	probably damaging	1.00
R9236:Kif13b	UTSW	14	64744934	missense	probably benign	0.22
Z1176:Kif13b	UTSW	14	64803344	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGGAGGTAGCAGCATGATG -3'
(R):5'- AAAGCATTCATGGCCCTGC -3'

Sequencing Primer
(F):5'- TAGCAGCATGATGGATGAACAC -3'
(R):5'- ATGGCCCTGCTCCCATG -3'

Posted On

2016-03-17