Mutagenetix > Incidental Mutation

Incidental Mutation 'R4878:Ubr5'

375086

Institutional Source

Beutler Lab

Gene Symbol

Ubr5

Ensembl Gene

ENSMUSG00000037487

Gene Name

ubiquitin protein ligase E3 component n-recognin 5

Synonyms

Edd, 4432411E13Rik, Edd1

MMRRC Submission

042487-MU

Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4878 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37967328-38078854 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 38006564 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1149 (M1149K)

Ref Sequence

ENSEMBL: ENSMUSP00000105965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110336
AA Change: M1149K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: M1149K

Domain	Start	End	E-Value	Type
low complexity region	94	111	N/A	INTRINSIC
low complexity region	129	156	N/A	INTRINSIC
Pfam:E3_UbLigase_EDD	179	230	9.7e-35	PFAM
low complexity region	282	323	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
low complexity region	860	870	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
low complexity region	970	999	N/A	INTRINSIC
low complexity region	1140	1151	N/A	INTRINSIC
ZnF_UBR1	1177	1244	5.42e-27	SMART
low complexity region	1396	1405	N/A	INTRINSIC
low complexity region	1524	1537	N/A	INTRINSIC
low complexity region	1567	1613	N/A	INTRINSIC
low complexity region	1641	1657	N/A	INTRINSIC
low complexity region	1662	1687	N/A	INTRINSIC
low complexity region	1726	1742	N/A	INTRINSIC
low complexity region	1759	1789	N/A	INTRINSIC
low complexity region	1879	1890	N/A	INTRINSIC
low complexity region	1972	1983	N/A	INTRINSIC
low complexity region	1986	1997	N/A	INTRINSIC
Blast:HECTc	2271	2313	2e-6	BLAST
low complexity region	2329	2366	N/A	INTRINSIC
PolyA	2389	2452	3.97e-33	SMART
HECTc	2432	2798	1e-151	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226414
AA Change: M1155K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Predicted Effect

probably benign
Transcript: ENSMUST00000227143

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228101

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228504

Meta Mutation Damage Score

0.0582

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

96% (70/73)

MGI Phenotype

Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	C	A	4: 144,613,845	H47N	possibly damaging	Het
Adgrg3	A	T	8: 95,035,086	N159I	possibly damaging	Het
Agrn	A	T	4: 156,170,845	L1449Q	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Atg2a	A	T	19: 6,250,244	E694V	probably damaging	Het
Ccndbp1	T	A	2: 121,014,691	L363*	probably null	Het
Cdh16	A	T	8: 104,618,064	D478E	probably damaging	Het
Cep295	A	T	9: 15,334,956	W735R	probably benign	Het
Cnnm2	C	T	19: 46,859,083	P682S	probably benign	Het
Daam2	C	A	17: 49,460,710	R951L	probably damaging	Het
Dmxl1	T	A	18: 49,851,476	F180I	probably damaging	Het
Dnajc6	T	C	4: 101,599,034		probably benign	Het
Efemp2	A	T	19: 5,480,761		probably benign	Het
Emilin1	A	G	5: 30,917,066	D217G	probably benign	Het
Enpep	A	T	3: 129,276,771	M829K	probably benign	Het
Epb41l4a	A	G	18: 33,798,572	V623A	probably damaging	Het
Erlin2	T	A	8: 27,027,166		probably null	Het
Fbln2	T	C	6: 91,256,995		probably null	Het
Gga3	A	T	11: 115,591,321	I157N	probably damaging	Het
Gm884	A	G	11: 103,617,891		probably benign	Het
Gtpbp6	C	T	5: 110,107,311		probably benign	Het
Hps4	T	C	5: 112,375,368	V584A	probably benign	Het
Ighv1-50	T	C	12: 115,119,947	Y51C	probably benign	Het
Kif13b	T	C	14: 64,806,154	L1801P	probably benign	Het
Kif16b	T	C	2: 142,848,003	I330V	probably damaging	Het
Klb	A	T	5: 65,348,490	R27W	probably damaging	Het
Lrif1	A	T	3: 106,735,640	K169M	probably damaging	Het
Met	A	G	6: 17,549,059	D970G	probably damaging	Het
Mical3	A	T	6: 120,969,387	M1051K	possibly damaging	Het
Mios	A	G	6: 8,215,094	N97D	probably benign	Het
Msh5	G	A	17: 35,038,456	R321C	probably damaging	Het
Mybpc1	T	C	10: 88,551,430	Q473R	possibly damaging	Het
Ncoa1	C	T	12: 4,275,004	G970D	probably damaging	Het
Neb	T	C	2: 52,219,394	Y232C	probably damaging	Het
Nefh	A	G	11: 4,941,333	S429P	probably damaging	Het
Notch3	C	T	17: 32,147,085	G1014D	probably damaging	Het
Nup107	A	T	10: 117,751,418	C859S	probably benign	Het
Olfr1033	A	G	2: 86,041,455	I47V	probably benign	Het
Olfr136	T	G	17: 38,335,627	F157V	probably benign	Het
Olfr412	T	C	11: 74,364,848	Y60H	probably damaging	Het
Otud7b	T	A	3: 96,136,510		probably benign	Het
Pde1a	A	T	2: 79,878,139	S312T	probably benign	Het
Piwil1	G	T	5: 128,740,981	R94L	probably damaging	Het
Pnma2	G	A	14: 66,917,054	W309*	probably null	Het
Ppef2	A	C	5: 92,228,740		probably null	Het
Rabac1	T	A	7: 24,969,967	Q212L	possibly damaging	Het
Rad51	T	C	2: 119,120,492		probably benign	Het
Rbm48	A	T	5: 3,591,853		probably benign	Het
Rft1	C	T	14: 30,677,804	S315L	probably benign	Het
Rgs13	C	T	1: 144,171,479	M1I	probably null	Het
Rhbg	A	C	3: 88,247,453	S215A	probably benign	Het
Rufy2	A	T	10: 63,002,211	N379I	probably damaging	Het
Slc17a1	T	C	13: 23,880,654	L367P	probably damaging	Het
Slc25a39	G	A	11: 102,403,675	R308C	probably benign	Het
Smo	A	G	6: 29,753,571	T149A	probably benign	Het
Sqle	A	G	15: 59,316,085	K81E	probably benign	Het
Tfpi	A	G	2: 84,452,555		probably null	Het
Tnk2	A	G	16: 32,679,630	D572G	probably damaging	Het
Utrn	T	A	10: 12,727,758	Q626L	probably damaging	Het
Virma	T	A	4: 11,544,971	H1643Q	probably damaging	Het
Wnt3	G	T	11: 103,808,205	G46C	possibly damaging	Het
Zkscan7	G	T	9: 122,890,800	G184*	probably null	Het

Other mutations in Ubr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ubr5	APN	15	37984036	missense	probably damaging	1.00
IGL00548:Ubr5	APN	15	38004321	missense	probably benign	0.11
IGL00675:Ubr5	APN	15	38018284	missense	possibly damaging	0.84
IGL00770:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00774:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00919:Ubr5	APN	15	38040842	missense	probably damaging	1.00
IGL00962:Ubr5	APN	15	37985934	missense	probably damaging	1.00
IGL01328:Ubr5	APN	15	37981523	missense	possibly damaging	0.82
IGL01359:Ubr5	APN	15	37973006	missense	probably damaging	0.96
IGL01394:Ubr5	APN	15	38009631	missense	possibly damaging	0.90
IGL01674:Ubr5	APN	15	37998379	missense	probably damaging	1.00
IGL01981:Ubr5	APN	15	37996598	missense	probably benign	0.08
IGL01993:Ubr5	APN	15	37973012	missense	probably damaging	0.99
IGL02159:Ubr5	APN	15	37991379	splice site	probably benign
IGL02252:Ubr5	APN	15	38024894	missense	probably damaging	1.00
IGL02442:Ubr5	APN	15	38037901	missense	possibly damaging	0.95
IGL02502:Ubr5	APN	15	38030689	missense	probably benign	0.01
IGL02503:Ubr5	APN	15	38018320	missense	possibly damaging	0.90
IGL02503:Ubr5	APN	15	38018314	missense	probably damaging	0.99
IGL02546:Ubr5	APN	15	38008747	missense	probably benign	0.00
IGL02556:Ubr5	APN	15	38002448	missense	probably benign	0.18
IGL02647:Ubr5	APN	15	37992082	missense	probably damaging	0.99
IGL02679:Ubr5	APN	15	38002314	missense	probably benign	0.36
IGL02726:Ubr5	APN	15	38000562	splice site	probably benign
IGL02884:Ubr5	APN	15	37998376	missense	probably damaging	1.00
IGL02972:Ubr5	APN	15	38041952	missense	probably damaging	1.00
IGL03000:Ubr5	APN	15	38024852	missense	probably damaging	0.99
IGL03028:Ubr5	APN	15	38047593	missense	probably benign	0.00
IGL03057:Ubr5	APN	15	38040906	splice site	probably benign
IGL03085:Ubr5	APN	15	38029568	missense	probably damaging	1.00
IGL03198:Ubr5	APN	15	38045720	missense	probably damaging	1.00
IGL03368:Ubr5	APN	15	37998316	missense	probably damaging	0.96
Anchovy	UTSW	15	37979832	missense	probably null
P0016:Ubr5	UTSW	15	38000578	missense	probably damaging	1.00
PIT4142001:Ubr5	UTSW	15	38041909	missense
R0133:Ubr5	UTSW	15	37996571	missense	probably damaging	0.98
R0173:Ubr5	UTSW	15	38004675	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0314:Ubr5	UTSW	15	37997187	missense	probably damaging	0.99
R0379:Ubr5	UTSW	15	38018957	missense	probably benign	0.00
R0390:Ubr5	UTSW	15	38030672	missense	probably benign	0.19
R0415:Ubr5	UTSW	15	37972980	missense	probably damaging	0.98
R0531:Ubr5	UTSW	15	37991344	missense	probably benign	0.34
R0650:Ubr5	UTSW	15	38030807	splice site	probably benign
R0720:Ubr5	UTSW	15	37972991	missense	probably damaging	0.98
R1183:Ubr5	UTSW	15	37997175	missense	possibly damaging	0.71
R1302:Ubr5	UTSW	15	38041479	missense	possibly damaging	0.91
R1442:Ubr5	UTSW	15	38014924	splice site	probably benign
R1507:Ubr5	UTSW	15	37980870	missense	probably damaging	1.00
R1575:Ubr5	UTSW	15	38040841	missense	probably damaging	1.00
R1577:Ubr5	UTSW	15	38030730	missense	possibly damaging	0.76
R1622:Ubr5	UTSW	15	38009113	unclassified	probably benign
R1721:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1799:Ubr5	UTSW	15	37989377	missense	probably damaging	1.00
R1840:Ubr5	UTSW	15	37980917	missense	possibly damaging	0.51
R1867:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1868:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R2065:Ubr5	UTSW	15	38040842	missense	probably damaging	1.00
R2107:Ubr5	UTSW	15	37989302	missense	probably benign	0.00
R2201:Ubr5	UTSW	15	38002299	missense	possibly damaging	0.83
R2261:Ubr5	UTSW	15	37988284	missense	probably damaging	0.99
R2441:Ubr5	UTSW	15	37989345	missense	probably damaging	0.99
R2512:Ubr5	UTSW	15	38002319	missense	probably damaging	1.00
R3008:Ubr5	UTSW	15	38030845	missense	probably benign
R3412:Ubr5	UTSW	15	38004235	splice site	probably benign
R3898:Ubr5	UTSW	15	37997739	missense	probably benign	0.02
R3900:Ubr5	UTSW	15	38019242	missense	probably damaging	1.00
R4032:Ubr5	UTSW	15	38024837	missense
R4352:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R4362:Ubr5	UTSW	15	38078403	missense	probably damaging	0.99
R4467:Ubr5	UTSW	15	38004336	missense	probably damaging	1.00
R4507:Ubr5	UTSW	15	38013542	missense	probably damaging	0.96
R4683:Ubr5	UTSW	15	38037967	missense	probably damaging	1.00
R4771:Ubr5	UTSW	15	38018297	missense	possibly damaging	0.50
R4999:Ubr5	UTSW	15	38009668	missense	probably benign	0.06
R5057:Ubr5	UTSW	15	38004109	missense	probably damaging	0.98
R5177:Ubr5	UTSW	15	38006517	missense	probably benign	0.22
R5186:Ubr5	UTSW	15	37997916	missense	probably damaging	0.99
R5378:Ubr5	UTSW	15	37989578	missense	probably damaging	1.00
R5486:Ubr5	UTSW	15	38008739	missense	probably benign	0.00
R5494:Ubr5	UTSW	15	38019281	missense	possibly damaging	0.78
R5617:Ubr5	UTSW	15	38030657	missense	possibly damaging	0.47
R5636:Ubr5	UTSW	15	37983996	missense	probably damaging	1.00
R5655:Ubr5	UTSW	15	38015093	missense	probably damaging	0.99
R5715:Ubr5	UTSW	15	38002233	missense	probably benign	0.06
R5781:Ubr5	UTSW	15	38006541	missense	probably benign	0.27
R6645:Ubr5	UTSW	15	38029506	missense	probably damaging	1.00
R6774:Ubr5	UTSW	15	38015135	missense	probably damaging	1.00
R6823:Ubr5	UTSW	15	37989598	missense	probably benign	0.08
R6877:Ubr5	UTSW	15	38002570	missense	probably damaging	0.98
R7105:Ubr5	UTSW	15	38008775	missense
R7166:Ubr5	UTSW	15	37976145	missense
R7514:Ubr5	UTSW	15	37988237	missense
R7523:Ubr5	UTSW	15	38004055	missense
R7631:Ubr5	UTSW	15	38029507	missense
R7709:Ubr5	UTSW	15	37979832	missense	probably null
R7710:Ubr5	UTSW	15	37979832	missense	probably null
R7712:Ubr5	UTSW	15	37979832	missense	probably null
R7803:Ubr5	UTSW	15	37979832	missense	probably null
R7816:Ubr5	UTSW	15	37979832	missense	probably null
R7817:Ubr5	UTSW	15	37979832	missense	probably null
R7821:Ubr5	UTSW	15	37997187	missense	probably damaging	0.96
R7824:Ubr5	UTSW	15	37991322	missense	probably damaging	0.97
R7841:Ubr5	UTSW	15	37980906	missense
R7869:Ubr5	UTSW	15	37979832	missense	probably null
R7896:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R8191:Ubr5	UTSW	15	38006507	missense
R8342:Ubr5	UTSW	15	38024837	missense
R8745:Ubr5	UTSW	15	38024795	missense
R8811:Ubr5	UTSW	15	38040879	missense
R8904:Ubr5	UTSW	15	38041909	missense
R8955:Ubr5	UTSW	15	38029581	missense
R8956:Ubr5	UTSW	15	38015123	missense	probably damaging	1.00
R9051:Ubr5	UTSW	15	38002259	missense
R9102:Ubr5	UTSW	15	38018352	missense
R9183:Ubr5	UTSW	15	37997176	missense
R9235:Ubr5	UTSW	15	38045738	missense
R9392:Ubr5	UTSW	15	37984007	missense
R9473:Ubr5	UTSW	15	38002373	missense
R9596:Ubr5	UTSW	15	37985969	missense
R9659:Ubr5	UTSW	15	37984010	missense
R9683:Ubr5	UTSW	15	37978027	missense
RF024:Ubr5	UTSW	15	38028652	missense
X0024:Ubr5	UTSW	15	37992060	missense	probably damaging	1.00
Z1177:Ubr5	UTSW	15	38040755	missense

Predicted Primers

PCR Primer
(F):5'- TCAGCTCACGTCAAAGGAGG -3'
(R):5'- GCAAGATCTCTGGAAATGTGAGTG -3'

Sequencing Primer
(F):5'- GGGAAAGGGAATCCTGAAACC -3'
(R):5'- TGTGGATGAGCCTCTCCAG -3'

Posted On

2016-03-17