Incidental Mutation 'R4878:Sqle'
ID375087
Institutional Source Beutler Lab
Gene Symbol Sqle
Ensembl Gene ENSMUSG00000022351
Gene Namesqualene epoxidase
Synonyms
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location59315077-59331192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59316085 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 81 (K81E)
Ref Sequence ENSEMBL: ENSMUSP00000022977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022977] [ENSMUST00000100640]
Predicted Effect probably benign
Transcript: ENSMUST00000022977
AA Change: K81E

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022977
Gene: ENSMUSG00000022351
AA Change: K81E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 81 95 N/A INTRINSIC
Pfam:FAD_binding_3 121 434 1.4e-22 PFAM
Pfam:SE 275 546 1.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100640
AA Change: K81E

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000098205
Gene: ENSMUSG00000022351
AA Change: K81E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 81 95 N/A INTRINSIC
Pfam:FAD_binding_3 121 344 3.4e-18 PFAM
Pfam:SE 275 370 3.5e-34 PFAM
Pfam:SE 365 514 5.7e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184208
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Squalene epoxidase catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die before E8.5 with a phenotype consistent with that found in mice with mutations affecting cholesterol synthesis. Mice heterozygous the allele exhibit improved Rett syndrome phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Sqle
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Sqle APN 15 59326619 missense probably damaging 1.00
IGL01396:Sqle APN 15 59323874 missense probably damaging 1.00
IGL02852:Sqle APN 15 59326071 missense probably damaging 1.00
IGL03037:Sqle APN 15 59321397 missense probably damaging 1.00
PIT4431001:Sqle UTSW 15 59323660 missense probably benign 0.03
R1678:Sqle UTSW 15 59324509 missense probably damaging 1.00
R2047:Sqle UTSW 15 59326058 missense probably benign 0.08
R2075:Sqle UTSW 15 59323901 missense probably damaging 0.99
R2156:Sqle UTSW 15 59323729 critical splice donor site probably null
R4773:Sqle UTSW 15 59317839 missense possibly damaging 0.54
R4915:Sqle UTSW 15 59321369 nonsense probably null
R5439:Sqle UTSW 15 59330904 missense probably benign 0.02
R5936:Sqle UTSW 15 59330829 missense probably damaging 1.00
R6374:Sqle UTSW 15 59316110 missense possibly damaging 0.75
R7286:Sqle UTSW 15 59316052 missense probably benign 0.00
R7373:Sqle UTSW 15 59317809 missense probably benign
R7386:Sqle UTSW 15 59330754 missense probably benign 0.30
R7387:Sqle UTSW 15 59330754 missense probably benign 0.30
R7624:Sqle UTSW 15 59330754 missense probably benign 0.30
R7685:Sqle UTSW 15 59316041 missense probably benign 0.00
R7731:Sqle UTSW 15 59315972 missense probably benign 0.20
X0027:Sqle UTSW 15 59317823 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTCACCCTGGCCAACAAG -3'
(R):5'- TTTCATCTTCCCTAAGAGCACAGC -3'

Sequencing Primer
(F):5'- TGGCCAACAAGGAGCTCC -3'
(R):5'- GTCCAGAACTTTAAGAAACGCAATC -3'
Posted On2016-03-17