Incidental Mutation 'R4878:Tnk2'
ID375088
Institutional Source Beutler Lab
Gene Symbol Tnk2
Ensembl Gene ENSMUSG00000022791
Gene Nametyrosine kinase, non-receptor, 2
SynonymsACK1, Ack, P21cdc42Hs kinase, Pyk1, activated p21cdc42Hs kinase
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location32643874-32683493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32679630 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 572 (D572G)
Ref Sequence ENSEMBL: ENSMUSP00000110778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115120] [ENSMUST00000115121] [ENSMUST00000115122] [ENSMUST00000115123] [ENSMUST00000115124] [ENSMUST00000115125] [ENSMUST00000115126] [ENSMUST00000131238] [ENSMUST00000152361]
Predicted Effect probably damaging
Transcript: ENSMUST00000115120
AA Change: D82G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110773
Gene: ENSMUSG00000022791
AA Change: D82G

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 1.1e-8 PFAM
low complexity region 247 264 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 284 351 2.9e-30 PFAM
low complexity region 391 419 N/A INTRINSIC
Pfam:UBA 467 505 2.7e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115121
AA Change: D97G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110774
Gene: ENSMUSG00000022791
AA Change: D97G

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 4.5e-9 PFAM
low complexity region 27 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115122
Predicted Effect probably damaging
Transcript: ENSMUST00000115123
AA Change: D572G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110776
Gene: ENSMUSG00000022791
AA Change: D572G

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 3e-30 PFAM
low complexity region 881 909 N/A INTRINSIC
Pfam:UBA 957 995 1.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115124
AA Change: D587G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110777
Gene: ENSMUSG00000022791
AA Change: D587G

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 855 5.3e-29 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115125
AA Change: D572G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110778
Gene: ENSMUSG00000022791
AA Change: D572G

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 7.2e-31 PFAM
low complexity region 881 909 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115126
AA Change: D587G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110779
Gene: ENSMUSG00000022791
AA Change: D587G

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 856 2.9e-30 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131238
AA Change: D82G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129382
Gene: ENSMUSG00000022791
AA Change: D82G

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152361
AA Change: D82G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125905
Gene: ENSMUSG00000022791
AA Change: D82G

DomainStartEndE-ValueType
SCOP:d1jo8a_ 8 38 2e-3 SMART
Pfam:GTPase_binding 39 106 2.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232650
Meta Mutation Damage Score 0.4874 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase that binds Cdc42Hs in its GTP-bound form and inhibits both the intrinsic and GTPase-activating protein (GAP)-stimulated GTPase activity of Cdc42Hs. This binding is mediated by a unique sequence of 47 amino acids C-terminal to an SH3 domain. The protein may be involved in a regulatory mechanism that sustains the GTP-bound active form of Cdc42Hs and which is directly linked to a tyrosine phosphorylation signal transduction pathway. Several alternatively spliced transcript variants have been identified from this gene, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Tnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Tnk2 APN 16 32680680 missense probably damaging 0.99
IGL02212:Tnk2 APN 16 32680142 missense probably damaging 0.97
IGL02445:Tnk2 APN 16 32675590 missense probably benign 0.00
IGL02799:Tnk2 UTSW 16 32665881 splice site probably benign
R0310:Tnk2 UTSW 16 32680590 missense probably benign
R0989:Tnk2 UTSW 16 32680358 missense probably damaging 1.00
R1556:Tnk2 UTSW 16 32670919 critical splice donor site probably null
R1851:Tnk2 UTSW 16 32679462 missense probably damaging 1.00
R1854:Tnk2 UTSW 16 32680142 missense probably damaging 0.97
R1938:Tnk2 UTSW 16 32663742 start gained probably benign
R2137:Tnk2 UTSW 16 32670802 splice site probably null
R2189:Tnk2 UTSW 16 32671421 missense probably damaging 1.00
R3772:Tnk2 UTSW 16 32679822 missense probably damaging 1.00
R4037:Tnk2 UTSW 16 32670796 missense probably damaging 1.00
R4413:Tnk2 UTSW 16 32669501 missense probably damaging 1.00
R4751:Tnk2 UTSW 16 32679857 missense probably damaging 1.00
R4983:Tnk2 UTSW 16 32680465 missense probably damaging 1.00
R5063:Tnk2 UTSW 16 32670850 missense probably damaging 1.00
R5541:Tnk2 UTSW 16 32669523 missense probably benign 0.07
R5759:Tnk2 UTSW 16 32680664 missense probably benign
R5888:Tnk2 UTSW 16 32671367 missense probably damaging 1.00
R6142:Tnk2 UTSW 16 32670099 missense probably damaging 1.00
R6372:Tnk2 UTSW 16 32679785 missense probably damaging 1.00
R6717:Tnk2 UTSW 16 32670869 missense probably damaging 1.00
R6939:Tnk2 UTSW 16 32663878 missense probably damaging 1.00
R7157:Tnk2 UTSW 16 32681168 missense probably damaging 1.00
R7292:Tnk2 UTSW 16 32680800 missense probably benign
R7362:Tnk2 UTSW 16 32675520 critical splice acceptor site probably null
R7477:Tnk2 UTSW 16 32677891 splice site probably null
R7558:Tnk2 UTSW 16 32680085 missense probably benign
R7665:Tnk2 UTSW 16 32680526 missense probably damaging 1.00
R7731:Tnk2 UTSW 16 32670134 missense possibly damaging 0.69
R7867:Tnk2 UTSW 16 32681235 missense probably damaging 0.99
R8011:Tnk2 UTSW 16 32668365 missense probably benign 0.00
R8167:Tnk2 UTSW 16 32680262 missense probably damaging 1.00
X0063:Tnk2 UTSW 16 32670850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAACATACGACCCTGTGAG -3'
(R):5'- GGAGCAGACCTCAAAGTCATCC -3'

Sequencing Primer
(F):5'- CATACGACCCTGTGAGTGAGGAC -3'
(R):5'- AAAGTCATCCTCATCCTGGGC -3'
Posted On2016-03-17