Incidental Mutation 'R4878:Olfr136'
ID375091
Institutional Source Beutler Lab
Gene Symbol Olfr136
Ensembl Gene ENSMUSG00000096840
Gene Nameolfactory receptor 136
SynonymsGA_x6K02T2PSCP-2779375-2780313, MOR256-7
MMRRC Submission 042487-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location38329831-38336643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 38335627 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 157 (F157V)
Ref Sequence ENSEMBL: ENSMUSP00000149856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077203] [ENSMUST00000208525] [ENSMUST00000208539] [ENSMUST00000214035] [ENSMUST00000216963]
AlphaFold Q8VG72
Predicted Effect probably benign
Transcript: ENSMUST00000077203
AA Change: F157V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076443
Gene: ENSMUSG00000096840
AA Change: F157V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-48 PFAM
Pfam:7tm_1 41 290 7.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208525
AA Change: F157V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208539
AA Change: F157V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214035
AA Change: F157V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216963
AA Change: F157V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Cnnm2 C T 19: 46,859,083 P682S probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Olfr136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Olfr136 APN 17 38335957 missense probably benign 0.00
IGL01787:Olfr136 APN 17 38335579 missense probably damaging 0.98
IGL02480:Olfr136 APN 17 38335423 missense probably benign 0.32
IGL02603:Olfr136 APN 17 38335513 missense probably damaging 1.00
IGL03122:Olfr136 APN 17 38335301 missense probably benign 0.01
BB009:Olfr136 UTSW 17 38335255 missense probably benign 0.01
BB019:Olfr136 UTSW 17 38335255 missense probably benign 0.01
R0295:Olfr136 UTSW 17 38335291 missense probably damaging 1.00
R0684:Olfr136 UTSW 17 38335844 missense probably benign 0.11
R1874:Olfr136 UTSW 17 38335969 missense probably damaging 1.00
R3436:Olfr136 UTSW 17 38335432 missense probably damaging 1.00
R3437:Olfr136 UTSW 17 38335432 missense probably damaging 1.00
R4714:Olfr136 UTSW 17 38335840 missense possibly damaging 0.65
R4715:Olfr136 UTSW 17 38335840 missense possibly damaging 0.65
R4716:Olfr136 UTSW 17 38335840 missense possibly damaging 0.65
R5296:Olfr136 UTSW 17 38335456 nonsense probably null
R5370:Olfr136 UTSW 17 38335444 nonsense probably null
R5413:Olfr136 UTSW 17 38335624 missense probably benign 0.03
R5988:Olfr136 UTSW 17 38336020 missense probably damaging 1.00
R6156:Olfr136 UTSW 17 38335173 missense probably damaging 0.99
R6550:Olfr136 UTSW 17 38336005 missense possibly damaging 0.65
R7395:Olfr136 UTSW 17 38335864 nonsense probably null
R7417:Olfr136 UTSW 17 38335292 missense probably damaging 1.00
R7746:Olfr136 UTSW 17 38335394 missense probably benign 0.16
R7747:Olfr136 UTSW 17 38335394 missense probably benign 0.16
R7821:Olfr136 UTSW 17 38335964 missense probably benign 0.13
R7932:Olfr136 UTSW 17 38335255 missense probably benign 0.01
R8409:Olfr136 UTSW 17 38335306 missense probably benign 0.09
R8911:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R8912:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R8913:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R8914:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R8968:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R9006:Olfr136 UTSW 17 38335832 missense possibly damaging 0.84
R9044:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R9110:Olfr136 UTSW 17 38335543 missense probably damaging 1.00
R9155:Olfr136 UTSW 17 38335333 missense not run
V5088:Olfr136 UTSW 17 38335159 start codon destroyed probably null 0.99
Z1176:Olfr136 UTSW 17 38335352 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGTTTAACCTGGGGAG -3'
(R):5'- TTAAGCACAGAGGAACAGCC -3'

Sequencing Primer
(F):5'- TGGGGAGCTCCAGAAAAACTATTAC -3'
(R):5'- GGAACAGCCAGTATAAAAATGCATAC -3'
Posted On2016-03-17