Mutagenetix > Incidental Mutation

Incidental Mutation 'R4878:Olfr136'

375091

Institutional Source

Beutler Lab

Gene Symbol

Olfr136

Ensembl Gene

ENSMUSG00000096840

Gene Name

olfactory receptor 136

Synonyms

GA_x6K02T2PSCP-2779375-2780313, MOR256-7

MMRRC Submission

042487-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R4878 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38329831-38336643 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 38335627 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 157 (F157V)

Ref Sequence

ENSEMBL: ENSMUSP00000149856 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077203] [ENSMUST00000208525] [ENSMUST00000208539] [ENSMUST00000214035] [ENSMUST00000216963]

AlphaFold

Q8VG72

Predicted Effect

probably benign
Transcript: ENSMUST00000077203
AA Change: F157V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000076443
Gene: ENSMUSG00000096840
AA Change: F157V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	2.6e-48	PFAM
Pfam:7tm_1	41	290	7.1e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000208525
AA Change: F157V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000208539
AA Change: F157V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000214035
AA Change: F157V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000216963
AA Change: F157V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	C	A	4: 144,613,845	H47N	possibly damaging	Het
Adgrg3	A	T	8: 95,035,086	N159I	possibly damaging	Het
Agrn	A	T	4: 156,170,845	L1449Q	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Atg2a	A	T	19: 6,250,244	E694V	probably damaging	Het
Ccndbp1	T	A	2: 121,014,691	L363*	probably null	Het
Cdh16	A	T	8: 104,618,064	D478E	probably damaging	Het
Cep295	A	T	9: 15,334,956	W735R	probably benign	Het
Cnnm2	C	T	19: 46,859,083	P682S	probably benign	Het
Daam2	C	A	17: 49,460,710	R951L	probably damaging	Het
Dmxl1	T	A	18: 49,851,476	F180I	probably damaging	Het
Dnajc6	T	C	4: 101,599,034		probably benign	Het
Efemp2	A	T	19: 5,480,761		probably benign	Het
Emilin1	A	G	5: 30,917,066	D217G	probably benign	Het
Enpep	A	T	3: 129,276,771	M829K	probably benign	Het
Epb41l4a	A	G	18: 33,798,572	V623A	probably damaging	Het
Erlin2	T	A	8: 27,027,166		probably null	Het
Fbln2	T	C	6: 91,256,995		probably null	Het
Gga3	A	T	11: 115,591,321	I157N	probably damaging	Het
Gm884	A	G	11: 103,617,891		probably benign	Het
Gtpbp6	C	T	5: 110,107,311		probably benign	Het
Hps4	T	C	5: 112,375,368	V584A	probably benign	Het
Ighv1-50	T	C	12: 115,119,947	Y51C	probably benign	Het
Kif13b	T	C	14: 64,806,154	L1801P	probably benign	Het
Kif16b	T	C	2: 142,848,003	I330V	probably damaging	Het
Klb	A	T	5: 65,348,490	R27W	probably damaging	Het
Lrif1	A	T	3: 106,735,640	K169M	probably damaging	Het
Met	A	G	6: 17,549,059	D970G	probably damaging	Het
Mical3	A	T	6: 120,969,387	M1051K	possibly damaging	Het
Mios	A	G	6: 8,215,094	N97D	probably benign	Het
Msh5	G	A	17: 35,038,456	R321C	probably damaging	Het
Mybpc1	T	C	10: 88,551,430	Q473R	possibly damaging	Het
Ncoa1	C	T	12: 4,275,004	G970D	probably damaging	Het
Neb	T	C	2: 52,219,394	Y232C	probably damaging	Het
Nefh	A	G	11: 4,941,333	S429P	probably damaging	Het
Notch3	C	T	17: 32,147,085	G1014D	probably damaging	Het
Nup107	A	T	10: 117,751,418	C859S	probably benign	Het
Olfr1033	A	G	2: 86,041,455	I47V	probably benign	Het
Olfr412	T	C	11: 74,364,848	Y60H	probably damaging	Het
Otud7b	T	A	3: 96,136,510		probably benign	Het
Pde1a	A	T	2: 79,878,139	S312T	probably benign	Het
Piwil1	G	T	5: 128,740,981	R94L	probably damaging	Het
Pnma2	G	A	14: 66,917,054	W309*	probably null	Het
Ppef2	A	C	5: 92,228,740		probably null	Het
Rabac1	T	A	7: 24,969,967	Q212L	possibly damaging	Het
Rad51	T	C	2: 119,120,492		probably benign	Het
Rbm48	A	T	5: 3,591,853		probably benign	Het
Rft1	C	T	14: 30,677,804	S315L	probably benign	Het
Rgs13	C	T	1: 144,171,479	M1I	probably null	Het
Rhbg	A	C	3: 88,247,453	S215A	probably benign	Het
Rufy2	A	T	10: 63,002,211	N379I	probably damaging	Het
Slc17a1	T	C	13: 23,880,654	L367P	probably damaging	Het
Slc25a39	G	A	11: 102,403,675	R308C	probably benign	Het
Smo	A	G	6: 29,753,571	T149A	probably benign	Het
Sqle	A	G	15: 59,316,085	K81E	probably benign	Het
Tfpi	A	G	2: 84,452,555		probably null	Het
Tnk2	A	G	16: 32,679,630	D572G	probably damaging	Het
Ubr5	A	T	15: 38,006,564	M1149K	probably benign	Het
Utrn	T	A	10: 12,727,758	Q626L	probably damaging	Het
Virma	T	A	4: 11,544,971	H1643Q	probably damaging	Het
Wnt3	G	T	11: 103,808,205	G46C	possibly damaging	Het
Zkscan7	G	T	9: 122,890,800	G184*	probably null	Het

Other mutations in Olfr136

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01712:Olfr136	APN	17	38335957	missense	probably benign	0.00
IGL01787:Olfr136	APN	17	38335579	missense	probably damaging	0.98
IGL02480:Olfr136	APN	17	38335423	missense	probably benign	0.32
IGL02603:Olfr136	APN	17	38335513	missense	probably damaging	1.00
IGL03122:Olfr136	APN	17	38335301	missense	probably benign	0.01
BB009:Olfr136	UTSW	17	38335255	missense	probably benign	0.01
BB019:Olfr136	UTSW	17	38335255	missense	probably benign	0.01
R0295:Olfr136	UTSW	17	38335291	missense	probably damaging	1.00
R0684:Olfr136	UTSW	17	38335844	missense	probably benign	0.11
R1874:Olfr136	UTSW	17	38335969	missense	probably damaging	1.00
R3436:Olfr136	UTSW	17	38335432	missense	probably damaging	1.00
R3437:Olfr136	UTSW	17	38335432	missense	probably damaging	1.00
R4714:Olfr136	UTSW	17	38335840	missense	possibly damaging	0.65
R4715:Olfr136	UTSW	17	38335840	missense	possibly damaging	0.65
R4716:Olfr136	UTSW	17	38335840	missense	possibly damaging	0.65
R5296:Olfr136	UTSW	17	38335456	nonsense	probably null
R5370:Olfr136	UTSW	17	38335444	nonsense	probably null
R5413:Olfr136	UTSW	17	38335624	missense	probably benign	0.03
R5988:Olfr136	UTSW	17	38336020	missense	probably damaging	1.00
R6156:Olfr136	UTSW	17	38335173	missense	probably damaging	0.99
R6550:Olfr136	UTSW	17	38336005	missense	possibly damaging	0.65
R7395:Olfr136	UTSW	17	38335864	nonsense	probably null
R7417:Olfr136	UTSW	17	38335292	missense	probably damaging	1.00
R7746:Olfr136	UTSW	17	38335394	missense	probably benign	0.16
R7747:Olfr136	UTSW	17	38335394	missense	probably benign	0.16
R7821:Olfr136	UTSW	17	38335964	missense	probably benign	0.13
R7932:Olfr136	UTSW	17	38335255	missense	probably benign	0.01
R8409:Olfr136	UTSW	17	38335306	missense	probably benign	0.09
R8911:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R8912:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R8913:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R8914:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R8968:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9006:Olfr136	UTSW	17	38335832	missense	possibly damaging	0.84
R9044:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9110:Olfr136	UTSW	17	38335543	missense	probably damaging	1.00
R9155:Olfr136	UTSW	17	38335333	missense	probably damaging	0.99
R9279:Olfr136	UTSW	17	38335523	missense	probably damaging	0.99
R9289:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9295:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9317:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9318:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9348:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9409:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9410:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9411:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9412:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9413:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9512:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9522:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9524:Olfr136	UTSW	17	38335649	nonsense	probably null
R9547:Olfr136	UTSW	17	38335450	missense	possibly damaging	0.80
R9580:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
V5088:Olfr136	UTSW	17	38335159	start codon destroyed	probably null	0.99
Z1176:Olfr136	UTSW	17	38335352	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCTGTTTAACCTGGGGAG -3'
(R):5'- TTAAGCACAGAGGAACAGCC -3'

Sequencing Primer
(F):5'- TGGGGAGCTCCAGAAAAACTATTAC -3'
(R):5'- GGAACAGCCAGTATAAAAATGCATAC -3'

Posted On

2016-03-17