Mutagenetix > Incidental Mutation

Incidental Mutation 'R4878:Cnnm2'

375098

Institutional Source

Beutler Lab

Gene Symbol

Cnnm2

Ensembl Gene

ENSMUSG00000064105

Gene Name

cyclin M2

Synonyms

Acdp2

MMRRC Submission

042487-MU

Accession Numbers

Genbank: NM_033569; MGI: 2151054

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4878 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46761596-46878795 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46859083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 682 (P682S)

Ref Sequence

ENSEMBL: ENSMUSP00000096972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077666] [ENSMUST00000099373]

AlphaFold

Q3TWN3

Predicted Effect

probably benign
Transcript: ENSMUST00000077666
AA Change: P682S

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000076850
Gene: ENSMUSG00000064105
AA Change: P682S

Domain	Start	End	E-Value	Type
low complexity region	28	39	N/A	INTRINSIC
low complexity region	41	54	N/A	INTRINSIC
low complexity region	56	67	N/A	INTRINSIC
low complexity region	194	227	N/A	INTRINSIC
Pfam:DUF21	257	431	7.8e-39	PFAM
Blast:CBS	455	505	3e-14	BLAST
Pfam:CBS	514	578	7.6e-6	PFAM
Blast:cNMP	649	805	2e-49	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000099373
AA Change: P682S

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000096972
Gene: ENSMUSG00000064105
AA Change: P682S

Domain	Start	End	E-Value	Type
low complexity region	28	39	N/A	INTRINSIC
low complexity region	41	54	N/A	INTRINSIC
low complexity region	56	67	N/A	INTRINSIC
low complexity region	194	227	N/A	INTRINSIC
Pfam:DUF21	257	431	2.6e-39	PFAM
Blast:CBS	455	505	3e-14	BLAST
Pfam:CBS	514	578	1.1e-5	PFAM
Blast:cNMP	649	827	1e-46	BLAST

Meta Mutation Damage Score

0.1593

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ancient conserved domain containing protein family. Members of this protein family contain a cyclin box motif and have structural similarity to the cyclins. The encoded protein may play an important role in magnesium homeostasis by mediating the epithelial transport and renal reabsorption of Mg2+. Mutations in this gene are associated with renal hypomagnesemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

All alleles(90) : Gene trapped(90)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	C	A	4: 144,613,845	H47N	possibly damaging	Het
Adgrg3	A	T	8: 95,035,086	N159I	possibly damaging	Het
Agrn	A	T	4: 156,170,845	L1449Q	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Atg2a	A	T	19: 6,250,244	E694V	probably damaging	Het
Ccndbp1	T	A	2: 121,014,691	L363*	probably null	Het
Cdh16	A	T	8: 104,618,064	D478E	probably damaging	Het
Cep295	A	T	9: 15,334,956	W735R	probably benign	Het
Daam2	C	A	17: 49,460,710	R951L	probably damaging	Het
Dmxl1	T	A	18: 49,851,476	F180I	probably damaging	Het
Dnajc6	T	C	4: 101,599,034		probably benign	Het
Efemp2	A	T	19: 5,480,761		probably benign	Het
Emilin1	A	G	5: 30,917,066	D217G	probably benign	Het
Enpep	A	T	3: 129,276,771	M829K	probably benign	Het
Epb41l4a	A	G	18: 33,798,572	V623A	probably damaging	Het
Erlin2	T	A	8: 27,027,166		probably null	Het
Fbln2	T	C	6: 91,256,995		probably null	Het
Gga3	A	T	11: 115,591,321	I157N	probably damaging	Het
Gm884	A	G	11: 103,617,891		probably benign	Het
Gtpbp6	C	T	5: 110,107,311		probably benign	Het
Hps4	T	C	5: 112,375,368	V584A	probably benign	Het
Ighv1-50	T	C	12: 115,119,947	Y51C	probably benign	Het
Kif13b	T	C	14: 64,806,154	L1801P	probably benign	Het
Kif16b	T	C	2: 142,848,003	I330V	probably damaging	Het
Klb	A	T	5: 65,348,490	R27W	probably damaging	Het
Lrif1	A	T	3: 106,735,640	K169M	probably damaging	Het
Met	A	G	6: 17,549,059	D970G	probably damaging	Het
Mical3	A	T	6: 120,969,387	M1051K	possibly damaging	Het
Mios	A	G	6: 8,215,094	N97D	probably benign	Het
Msh5	G	A	17: 35,038,456	R321C	probably damaging	Het
Mybpc1	T	C	10: 88,551,430	Q473R	possibly damaging	Het
Ncoa1	C	T	12: 4,275,004	G970D	probably damaging	Het
Neb	T	C	2: 52,219,394	Y232C	probably damaging	Het
Nefh	A	G	11: 4,941,333	S429P	probably damaging	Het
Notch3	C	T	17: 32,147,085	G1014D	probably damaging	Het
Nup107	A	T	10: 117,751,418	C859S	probably benign	Het
Olfr1033	A	G	2: 86,041,455	I47V	probably benign	Het
Olfr136	T	G	17: 38,335,627	F157V	probably benign	Het
Olfr412	T	C	11: 74,364,848	Y60H	probably damaging	Het
Otud7b	T	A	3: 96,136,510		probably benign	Het
Pde1a	A	T	2: 79,878,139	S312T	probably benign	Het
Piwil1	G	T	5: 128,740,981	R94L	probably damaging	Het
Pnma2	G	A	14: 66,917,054	W309*	probably null	Het
Ppef2	A	C	5: 92,228,740		probably null	Het
Rabac1	T	A	7: 24,969,967	Q212L	possibly damaging	Het
Rad51	T	C	2: 119,120,492		probably benign	Het
Rbm48	A	T	5: 3,591,853		probably benign	Het
Rft1	C	T	14: 30,677,804	S315L	probably benign	Het
Rgs13	C	T	1: 144,171,479	M1I	probably null	Het
Rhbg	A	C	3: 88,247,453	S215A	probably benign	Het
Rufy2	A	T	10: 63,002,211	N379I	probably damaging	Het
Slc17a1	T	C	13: 23,880,654	L367P	probably damaging	Het
Slc25a39	G	A	11: 102,403,675	R308C	probably benign	Het
Smo	A	G	6: 29,753,571	T149A	probably benign	Het
Sqle	A	G	15: 59,316,085	K81E	probably benign	Het
Tfpi	A	G	2: 84,452,555		probably null	Het
Tnk2	A	G	16: 32,679,630	D572G	probably damaging	Het
Ubr5	A	T	15: 38,006,564	M1149K	probably benign	Het
Utrn	T	A	10: 12,727,758	Q626L	probably damaging	Het
Virma	T	A	4: 11,544,971	H1643Q	probably damaging	Het
Wnt3	G	T	11: 103,808,205	G46C	possibly damaging	Het
Zkscan7	G	T	9: 122,890,800	G184*	probably null	Het

Other mutations in Cnnm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Cnnm2	APN	19	46763220	missense	probably damaging	1.00
IGL01971:Cnnm2	APN	19	46871676	missense	probably benign	0.19
IGL02003:Cnnm2	APN	19	46868559	missense	probably damaging	1.00
IGL02068:Cnnm2	APN	19	46877388	missense	possibly damaging	0.94
IGL02185:Cnnm2	APN	19	46762995	missense	probably benign	0.45
IGL02652:Cnnm2	APN	19	46763211	missense	probably damaging	1.00
IGL02682:Cnnm2	APN	19	46762076	missense	probably benign	0.37
IGL03009:Cnnm2	APN	19	46877355	missense	probably damaging	1.00
IGL03378:Cnnm2	APN	19	46878034	missense	possibly damaging	0.76
R1581:Cnnm2	UTSW	19	46763123	missense	probably damaging	0.99
R3700:Cnnm2	UTSW	19	46762551	missense	probably damaging	1.00
R3892:Cnnm2	UTSW	19	46761793	nonsense	probably null
R3911:Cnnm2	UTSW	19	46877936	missense	probably damaging	0.96
R4508:Cnnm2	UTSW	19	46877270	missense	probably benign	0.01
R4678:Cnnm2	UTSW	19	46763246	missense	possibly damaging	0.91
R5154:Cnnm2	UTSW	19	46763132	missense	probably benign	0.02
R5445:Cnnm2	UTSW	19	46877288	missense	possibly damaging	0.66
R5771:Cnnm2	UTSW	19	46856995	splice site	probably null
R5914:Cnnm2	UTSW	19	46763177	missense	probably benign	0.07
R6263:Cnnm2	UTSW	19	46856905	missense	probably benign	0.30
R6715:Cnnm2	UTSW	19	46853973	missense	probably damaging	1.00
R6881:Cnnm2	UTSW	19	46877219	missense	probably damaging	1.00
R7022:Cnnm2	UTSW	19	46762550	missense	probably damaging	0.98
R7022:Cnnm2	UTSW	19	46858940	splice site	probably null
R7486:Cnnm2	UTSW	19	46762074	missense	possibly damaging	0.94
R7600:Cnnm2	UTSW	19	46762067	missense	probably benign	0.02
R7648:Cnnm2	UTSW	19	46877900	missense	probably damaging	0.98
R7800:Cnnm2	UTSW	19	46877981	missense	probably benign	0.28
R8867:Cnnm2	UTSW	19	46762557	missense	probably damaging	0.99
R8971:Cnnm2	UTSW	19	46856923	missense	probably benign	0.28
R9433:Cnnm2	UTSW	19	46762368	missense	probably benign	0.23
R9463:Cnnm2	UTSW	19	46762551	missense	probably damaging	1.00
X0017:Cnnm2	UTSW	19	46762463	missense	probably benign	0.05
X0018:Cnnm2	UTSW	19	46762773	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATTGCTAGCACGGCCTTTG -3'
(R):5'- TATGCAAGTGGGGTTCCAG -3'

Sequencing Primer
(F):5'- GCCCTTCCTTGAAGTGTAATGTCAAG -3'
(R):5'- GTTCCAGAACCGCCCCC -3'

Posted On

2016-03-17