Incidental Mutation 'R4878:Cnnm2'
ID375098
Institutional Source Beutler Lab
Gene Symbol Cnnm2
Ensembl Gene ENSMUSG00000064105
Gene Namecyclin M2
SynonymsAcdp2
MMRRC Submission 042487-MU
Accession Numbers

Genbank: NM_033569; MGI: 2151054

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4878 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location46761596-46878795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46859083 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 682 (P682S)
Ref Sequence ENSEMBL: ENSMUSP00000096972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077666] [ENSMUST00000099373]
Predicted Effect probably benign
Transcript: ENSMUST00000077666
AA Change: P682S

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076850
Gene: ENSMUSG00000064105
AA Change: P682S

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
low complexity region 194 227 N/A INTRINSIC
Pfam:DUF21 257 431 7.8e-39 PFAM
Blast:CBS 455 505 3e-14 BLAST
Pfam:CBS 514 578 7.6e-6 PFAM
Blast:cNMP 649 805 2e-49 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000099373
AA Change: P682S

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096972
Gene: ENSMUSG00000064105
AA Change: P682S

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
low complexity region 194 227 N/A INTRINSIC
Pfam:DUF21 257 431 2.6e-39 PFAM
Blast:CBS 455 505 3e-14 BLAST
Pfam:CBS 514 578 1.1e-5 PFAM
Blast:cNMP 649 827 1e-46 BLAST
Meta Mutation Damage Score 0.1593 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ancient conserved domain containing protein family. Members of this protein family contain a cyclin box motif and have structural similarity to the cyclins. The encoded protein may play an important role in magnesium homeostasis by mediating the epithelial transport and renal reabsorption of Mg2+. Mutations in this gene are associated with renal hypomagnesemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(90) : Gene trapped(90)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 C A 4: 144,613,845 H47N possibly damaging Het
Adgrg3 A T 8: 95,035,086 N159I possibly damaging Het
Agrn A T 4: 156,170,845 L1449Q probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atg2a A T 19: 6,250,244 E694V probably damaging Het
Ccndbp1 T A 2: 121,014,691 L363* probably null Het
Cdh16 A T 8: 104,618,064 D478E probably damaging Het
Cep295 A T 9: 15,334,956 W735R probably benign Het
Daam2 C A 17: 49,460,710 R951L probably damaging Het
Dmxl1 T A 18: 49,851,476 F180I probably damaging Het
Dnajc6 T C 4: 101,599,034 probably benign Het
Efemp2 A T 19: 5,480,761 probably benign Het
Emilin1 A G 5: 30,917,066 D217G probably benign Het
Enpep A T 3: 129,276,771 M829K probably benign Het
Epb41l4a A G 18: 33,798,572 V623A probably damaging Het
Erlin2 T A 8: 27,027,166 probably null Het
Fbln2 T C 6: 91,256,995 probably null Het
Gga3 A T 11: 115,591,321 I157N probably damaging Het
Gm884 A G 11: 103,617,891 probably benign Het
Gtpbp6 C T 5: 110,107,311 probably benign Het
Hps4 T C 5: 112,375,368 V584A probably benign Het
Ighv1-50 T C 12: 115,119,947 Y51C probably benign Het
Kif13b T C 14: 64,806,154 L1801P probably benign Het
Kif16b T C 2: 142,848,003 I330V probably damaging Het
Klb A T 5: 65,348,490 R27W probably damaging Het
Lrif1 A T 3: 106,735,640 K169M probably damaging Het
Met A G 6: 17,549,059 D970G probably damaging Het
Mical3 A T 6: 120,969,387 M1051K possibly damaging Het
Mios A G 6: 8,215,094 N97D probably benign Het
Msh5 G A 17: 35,038,456 R321C probably damaging Het
Mybpc1 T C 10: 88,551,430 Q473R possibly damaging Het
Ncoa1 C T 12: 4,275,004 G970D probably damaging Het
Neb T C 2: 52,219,394 Y232C probably damaging Het
Nefh A G 11: 4,941,333 S429P probably damaging Het
Notch3 C T 17: 32,147,085 G1014D probably damaging Het
Nup107 A T 10: 117,751,418 C859S probably benign Het
Olfr1033 A G 2: 86,041,455 I47V probably benign Het
Olfr136 T G 17: 38,335,627 F157V probably benign Het
Olfr412 T C 11: 74,364,848 Y60H probably damaging Het
Otud7b T A 3: 96,136,510 probably benign Het
Pde1a A T 2: 79,878,139 S312T probably benign Het
Piwil1 G T 5: 128,740,981 R94L probably damaging Het
Pnma2 G A 14: 66,917,054 W309* probably null Het
Ppef2 A C 5: 92,228,740 probably null Het
Rabac1 T A 7: 24,969,967 Q212L possibly damaging Het
Rad51 T C 2: 119,120,492 probably benign Het
Rbm48 A T 5: 3,591,853 probably benign Het
Rft1 C T 14: 30,677,804 S315L probably benign Het
Rgs13 C T 1: 144,171,479 M1I probably null Het
Rhbg A C 3: 88,247,453 S215A probably benign Het
Rufy2 A T 10: 63,002,211 N379I probably damaging Het
Slc17a1 T C 13: 23,880,654 L367P probably damaging Het
Slc25a39 G A 11: 102,403,675 R308C probably benign Het
Smo A G 6: 29,753,571 T149A probably benign Het
Sqle A G 15: 59,316,085 K81E probably benign Het
Tfpi A G 2: 84,452,555 probably null Het
Tnk2 A G 16: 32,679,630 D572G probably damaging Het
Ubr5 A T 15: 38,006,564 M1149K probably benign Het
Utrn T A 10: 12,727,758 Q626L probably damaging Het
Virma T A 4: 11,544,971 H1643Q probably damaging Het
Wnt3 G T 11: 103,808,205 G46C possibly damaging Het
Zkscan7 G T 9: 122,890,800 G184* probably null Het
Other mutations in Cnnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Cnnm2 APN 19 46763220 missense probably damaging 1.00
IGL01971:Cnnm2 APN 19 46871676 missense probably benign 0.19
IGL02003:Cnnm2 APN 19 46868559 missense probably damaging 1.00
IGL02068:Cnnm2 APN 19 46877388 missense possibly damaging 0.94
IGL02185:Cnnm2 APN 19 46762995 missense probably benign 0.45
IGL02652:Cnnm2 APN 19 46763211 missense probably damaging 1.00
IGL02682:Cnnm2 APN 19 46762076 missense probably benign 0.37
IGL03009:Cnnm2 APN 19 46877355 missense probably damaging 1.00
IGL03378:Cnnm2 APN 19 46878034 missense possibly damaging 0.76
R1581:Cnnm2 UTSW 19 46763123 missense probably damaging 0.99
R3700:Cnnm2 UTSW 19 46762551 missense probably damaging 1.00
R3892:Cnnm2 UTSW 19 46761793 nonsense probably null
R3911:Cnnm2 UTSW 19 46877936 missense probably damaging 0.96
R4508:Cnnm2 UTSW 19 46877270 missense probably benign 0.01
R4678:Cnnm2 UTSW 19 46763246 missense possibly damaging 0.91
R5154:Cnnm2 UTSW 19 46763132 missense probably benign 0.02
R5445:Cnnm2 UTSW 19 46877288 missense possibly damaging 0.66
R5771:Cnnm2 UTSW 19 46856995 intron probably null
R5914:Cnnm2 UTSW 19 46763177 missense probably benign 0.07
R6263:Cnnm2 UTSW 19 46856905 missense probably benign 0.30
R6715:Cnnm2 UTSW 19 46853973 missense probably damaging 1.00
R6881:Cnnm2 UTSW 19 46877219 missense probably damaging 1.00
R7022:Cnnm2 UTSW 19 46762550 missense probably damaging 0.98
R7022:Cnnm2 UTSW 19 46858940 splice site probably null
R7486:Cnnm2 UTSW 19 46762074 missense possibly damaging 0.94
R7600:Cnnm2 UTSW 19 46762067 missense probably benign 0.02
R7648:Cnnm2 UTSW 19 46877900 missense probably damaging 0.98
R7800:Cnnm2 UTSW 19 46877981 missense probably benign 0.28
X0017:Cnnm2 UTSW 19 46762463 missense probably benign 0.05
X0018:Cnnm2 UTSW 19 46762773 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTGCTAGCACGGCCTTTG -3'
(R):5'- TATGCAAGTGGGGTTCCAG -3'

Sequencing Primer
(F):5'- GCCCTTCCTTGAAGTGTAATGTCAAG -3'
(R):5'- GTTCCAGAACCGCCCCC -3'
Posted On2016-03-17